DC Chemicals
-Chemicals for Life Science
-competitive price and high quality!www.dcchemicals.com
COA of Bepirovirsen
Description:
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
Chemical Information
| Catalog | Featured products |
|---|---|
| Purity of current batch | >95% |
| CAS | 1403787-62-1 |
| Molecular Weight (MW) | |
| Molecular Formula | |
| Storage | 2 years -20°C Powder, 2 weeks 4°C in DMSO, 6 months -80°C in DMSO |
Handling:
Providing storage is as stated on the product vial and the vial is kept tightly sealed, the product can be stored for up to 24 months.
Wherever possible, you should prepare and use solutions on the same day. However, if you need to make up stock solutions in advance, we recommend that you store the solution as aliquots in tightly sealed vials at -20°C. Generally, these will be useable for up to one month. Before use, and prior to opening the vial we recommend that you allow your product to equilibrate to room temperature for at least 1 hour.
Wherever possible, you should prepare and use solutions on the same day. However, if you need to make up stock solutions in advance, we recommend that you store the solution as aliquots in tightly sealed vials at -20°C. Generally, these will be useable for up to one month. Before use, and prior to opening the vial we recommend that you allow your product to equilibrate to room temperature for at least 1 hour.