Antibacterial synergist 3 is a dual-acting inhibitor of biofilm (IC50 of PAO1: 0.40 μM and IC50 of PA14: 1.45 μM). Antibacterial synergist 3 reduces virulence production by inhibiting the quorum sensing (QS) system and induces iron deficiency in P. aeruginosa PAO1. Antibacterial synergist 3 enhances the efficacy of Tobramycin and Ciprofloxacin in a mouse wound infection model. Antibacterial synergist 3 can be used for the research of P. aeruginosa infections.

Angolamycin is a basic macrolide antibiotic active against Gram-positive bacteria.

Amidinomycin is mainly resistant to Gram-positive bacteria (weak).

Albonoursin, a microbial secondary metabolite, is an antibacterial peptide. Albonoursin displays antibacterial and antitumor activities.

Alahopcin is a dipeptide antibiotic with a broad antibacterial spectrum.

AK-968-11563024 is an inhibitor of marine V. vulnificus NAT [ (VIBVN)NAT] with an IC50 of 18.86 µM. NATs (Arylamine N-acetyltransferases) in marine V. vulnificus plays a role in drug metabolism, contributing to the development of drug resistance. Therefore, AK-968-11563024 can be utilized in research related to drug resistance.

9-tert-Butyldoxycycline exhibits immunomodulatory activity, alters the polarization states polymorphonuclear neutrophils, and ameliorates the inflammatory response in ischemia-reperfusion injury model. 9-tert-Butyldoxycycline is the ligand for ‘Tet-On’ switch system.

8-Nonynoic acid (non-8-ynoic acid) is a fatty acid that belongs to the group of octynoic acids. It exhibits antibacterial activity against gram-positive bacteria by binding to bacterial fatty acids. 8-Nonynoicacid also inhibits growth of gram-negative bacteria by inhibiting the synthesis of fatty acids. It is also capable of inhibiting growth of both aerobic and anaerobic bacteria in biochemical assays.

8-Hydroxyerythromycin is a semi-synthetic antibiotic with an antibacterial activity.

2,2',4'-Trichloroacetophenone (Compound 3) is an α-haloacetophenone analogue. 2,2',4'-Trichloroacetophenone exhibits good antibacterial activities against Xanthomonas oryzae pv. oryzae (Xoo) and Xanthomonas axonopodis pv. citri (Xac) with EC50 values of 0.54 and 2.02 mg/L, respectively. 2,2',4'-Trichloroacetophenone can be used for antibacteria study.

1-Aminoacridine (1-Acridinamine) is a bright fluorescent dye. 1-Aminoacridine acts as an anti-infective agent and mutagen due to its ability to interact with DNA.

11-Hydroxynovobiocin has anti-Gram-negative bacteria effect.

10-Deoxymethymycin (Antibiotic YC 17) displays antibiotic activity against Gram positive bacteria.

(R)-DS86760016 is the R-enantiomer of DS86760016 and a linker. Mc-Pro-PAB-MMAE can be used for synthesis of ADCs.

(E/Z)-MC4 is an enantiomer of the antibacterial agent MC4, which has antibacterial activity against a group of Staphylococcus aureus strains including MRSA, and has no significant toxicity to mammalian cells.

Targeting the bacterial sliding clamp peptide 46 is a short peptide targeting the bacterial sliding clamp(SC), inhibiting SC-dependent DNA synthesis.

JC19 is a a cysteine-reactive small molecule degrader of SARS-CoV-2 nsp14 with DC50 of 8.7 uM in HEK293T cells.

MBX3132 is a small mocule inhibitor of AcrB multidrug efflux pump, fully potentiates the activity of a broad range of antibiotics at 0.1 uM; does not exhibit membrane-disrupting or antibacterial activity.

SSAA09E2 is a novel inhibitor of SARS-CoV replication, acting by blocking early interactions of SARS-S with the receptor for SARS-CoV, Angiotensin Converting Enzyme-2 (ACE2)

​​COE2-2hexyl​​ represents an innovative class of antimicrobial agents, demonstrating broad-spectrum antibacterial activity through its unique conjugated oligoelectrolyte (COE) structure.

Furamidine (DB75) is abisbenzamidine derivative and an antiparasite agent. Furamidine is a potent, reversible and competitive tyrosyl-DNA phosphodiesterase 1 (TDP-1) inhibitor. Inhibition of TDP-1 by Furamidine is effective both with single- and double-stranded DNA substrates but is slightly stronger with the duplex DNA. Furamidine is also a selective and cell-permeable protein arginine methyltransferase 1 (PRMT1) inhibitor with an IC50 of 9.4 μM. Furamidine is selective for PRMT1 over PRMT5, PRMT6, and PRMT4 (CARM1) (IC50s of 166 µM, 283 µM, and >400 µM, respectively).

mCLB073 is an advanced, orally active small molecule agonist specifically designed to target Mtb adenylyl cyclase Rv1625c. As an optimized derivative of V-59, it demonstrates significantly enhanced potency and efficacy for in vivo applications. In cholesterol-based media, mCLB073 shows a remarkable 17-fold increase in activity against Mtb compared to its predecessor, V-59, while retaining favorable pharmacokinetic characteristics and a strong safety profile. In preclinical studies, oral administration of mCLB073 at 30 mg/kg led to a substantial reduction in Mtb colony-forming units (CFUs) in the lungs of mice, accompanied by a 45% decrease in lung pathology severity. These findings highlight its potential as a promising therapeutic candidate for tuberculosis treatment.

ATV006 is a potent, orally active antiviral agent and ester prodrugs of GS-441524. ATV006 inhibits the replication of SARS-CoV-2 and its variants. ATV006 can be used for SARS-CoV-2 research.

Savirin (S. aureus virulence inhibitor) is a small molecule that targets the agr (accessory gene regulator) quorum sensing system in Staphylococcus aureus (S. aureus). The agr system is a key regulatory pathway that controls the expression of virulence factors in S. aureus, which are critical for its pathogenicity. The system involves a two-component signal transduction pathway consisting of AgrC (a histidine kinase) and AgrA (a response regulator).

Xeruborbactam (QPX7728) is an ultrabroad-spectrum beta-lactamase inhibitor with remarkable activity against a wide range of beta-lactamases, including those that are typically resistant to other inhibitors.

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

Bersacapavir is a novel Hepatitis B Virus capsid assembly modulator.

MMV666810, a 2-aminopyrazine similar to MMV390048, is potent against asexual parasites at 5.94 nM, but against gametocytes, it has a 3.3-fold selectivity to late-stage gametocytes compared to earlier stages (early-stage gametocyte: IC50 603 ± 88 nM; late-stage gametocyte: IC50 179 ± 8 nM).

MMV674850 is potent against asexual stage parasites at 2.7 and 4.5 nM and preferentially targets early-stage gametocytes (early-stage gametocyte: IC50 4.5 ± 3.6 nM; late-stage gametocyte: IC50 28.7 ± 0.2 nM).

Pyribencarb is a benzylcarbamate-type fungicide, which is active against a wide range of plant pathogenic fungi. Pyribencarb is a potent Qo inhibitor of cytochrome b. Pyribencarb is especially active against Botrytis cinerea and Sclerotinia sclerotirum.