Alternate TextTo enhance service speed and avoid tariff delays, we've opened a US warehouse. All US orders ship directly from our US facility.
Home > Inhibitors & Agonists > Antibiotics and Antivirals > HBV

HBV

You can also try the following methods, and our professionals will serve you Customized Consultation
Cat. No. Product Name Field of Application Chemical Structure
DC72979 DF-006
DF-006 is a small molecule, orally active Alpha-kinase 1 (ALPK1) agonist, activates ALPK1 and stimulates host innate immunity locally in liver, DF-006 enacts potent anti-HBV responses in mouse models of HBV and in primary human hepatocytes.
More description
DC79553 Di-Val-L-dC
Di-Val-L-dC, a prodrug of L-deoxycytidine, is a selective and specific anti-HBV agent.
More description
DC79313 KR-26556
KR-26556 is a sulfonamide type hepatitis B virus (HBV) capsid assembly regulator. KR-26556 exhibits anti-HBV activity with an EC50 of 0.04 μM. KR-26556 has favorable safety characteristics. KR-26556 can be used for research on chronic hepatitis B.
More description
DC79183 CCC-0975
CCC-0975 is a hepatitis B virus (HBV) inhibitor (EC50=10 μM). CCC-0975 interferes with the conversion of relaxed circular DNA (rcDNA) to cccDNA, synchronously reducing cccDNA and its precursor deproteinized rcDNA (DP-rcDNA) without promoting their intracellular degradation. CCC-0975 is promising for research of chronic hepatitis B.
More description
DC79100 AT-61
AT-61 is a non nucleoside HBV replication inhibitor. AT-61 prevents the capsid formation of pre genomic RNA, resulting in the production of empty capsids. AT-61 has the activity of drug-resistant mutant strains. AT-61 can be used for research on hepatitis B virus infection.
More description
DC79013 VNRX-9945
VNRX-9945 is a potent, broadly and orally active HBV CAM (capsid assembly modulator) with an EC50 of 2.6 nM. VNRX-9945 exhibits excellent and broad antiviral activity against multiple HBV genotypes in vitro, along with favorable pharmacokinetic profiles across multiple species. VNRX-9945 demonstrates robust antiviral efficacy in the adeno-associated virus mice models of HBV (AAV-HBV) infection.
More description
DC78702 ALG-001075
ALG-001075, a capsid assembly modulator (CAM), is an orally active HBV inhibitor. ALG-001075 effectively blocks not only HBV DNA production but also extracellular HBsAg/HBeAg and intracellular HBV RNA in primary human hepatocytes. ALG-001075 shows pronounced reductions of circulating HBV DNA in the AAV-HBV mouse model. ALG-001075 can be used for the study of Chronic hepatitis B (CHB).
More description
DC77993 Tomligisiran
Tomligisiran is a siRNA in JNJ-3989 (JNJ-73763989). JNJ-3989 is comprised of 2 siRNAs (Daplusiran and Tomligisiran), that target hepatitis B virus (HBV) mRNAs for degradation, thereby inhibiting HBV replication.
More description
DC77992 Tomligisiran sodium
Tomligisiran sodium is a siRNA in JNJ-3989 (JNJ-73763989). JNJ-3989 is comprised of 2 siRNAs (Daplusiran and Tomligisiran), that target hepatitis B virus (HBV) mRNAs for degradation, thereby inhibiting HBV replication.
More description
DC77962 Ozisiran
Ozisiran, a siRNA, is a hepatitis B virus (HBV) RNA transcript reducer with antiviral activity.
More description
DC77961 Ozisiran sodium
Ozisiran sodium, a siRNA, is a hepatitis B virus (HBV) RNA transcript reducer with antiviral activity.
More description
DC77884 Daplusiran
Daplusiran is a siRNA in JNJ-3989 (JNJ-73763989). JNJ-3989 is comprised of 2 siRNAs (Daplusiran and Tomligisiran), that target hepatitis B virus (HBV) mRNAs for degradation, thereby inhibiting HBV replication.
More description
DC77883 Daplusiran sodium
Daplusiran sodium is a siRNA in JNJ-3989 (JNJ-73763989). JNJ-3989 is comprised of 2 siRNAs (Daplusiran and Tomligisiran), that target hepatitis B virus (HBV) mRNAs for degradation, thereby inhibiting HBV replication.
More description
DC76051 Rapavir
Rapavir (JH-B10) is a selective and potent sodium taurocholate cotransporting polypeptide (NTCP) inhibitor with an IC50 value of 1.8 nM for the uptake of taurocholic acid-d4 (TCA-d4). Rapavir exerts antiviral activity by directly binding to NTCP and blocking the entry of the virus into cells during the HBV infection phase. Rapavir is promising for research of HBV infections.
More description
DC76050 Morphothiadin mesylate
Morphothiadin (GLS4) mesylate is a potent inhibitor of wild-type and Adefovir-resistant HBV replication with an IC50 value of 12 nM.
More description
DC76049 KR019
KR019 is a potent HBV capsid assembly modulator, exhibits potent antiviral activity in HBV-replicating cells. KR019 binds to the hydrophobic pocket at the core protein dimer-dimer interface, misdirecting capsid assembly into genome-free capsids and thereby inhibiting viral replication.
More description
DC76048 Destruxin B2
Destruxin B2 (compound 5) is a natural depsipeptide that can be inhibits hepatitis B surface antigen (HBsAg) secretion in Hep3B cells with an IC50 1.30 μM.
More description
DC76047 BA-AZT1
BA-AZT1 is the inhibitor for HBV polymerase and sodium taurocholate cotransporting polypeptide (NTCP). BA-AZT1 inhibits the secretion of viral capsid protein HBsAg and HBeAg with IC50 of 0.65 µM and 13.42 µM, inhibits the HBV DNA replication with an IC50 of 0.70 µM.
More description
DC76046 ALG-000184
ALG-000184, a prodrug of the potent Hhepatitis B virus (HBV) capsid assembly modulator ALG-001075, has the potential for the research of HBV infection research.
More description
DC76045 AIC263282
AIC263282 is a potent Hepatitis B Virus (HBV) capsid assembly modulator with an EC50 of 3.8 nM. AIC263282 shows an IC50 of 61 nM for hERG. AIC263282 exhibits activity against viral replication and hepatitis B surface antigen (HBsAG) on primary human hepatocytes.
More description
DC71481 Bepirovirsen Featured
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
More description
DC47062 Bersacapavir Featured
Bersacapavir is a novel Hepatitis B Virus capsid assembly modulator.
More description
DC72983 ZINC20451377 Featured
ZINC20451377 is a small molecule that binds to hepatitis B surface antigen (HBsAg) with high affinity (Kd=65.3 nM), reduces HBsAg levels and HBV virion secretion in cell culture model for HBV.
More description
DC72290 DVR-01 Featured
DVR-01 is a HBV inhibitor with EC50 values of 1.7 and 1.6 μM in AML12HBV10 and HepDES19 cells, respectively. DVR-01 shows antiviral activity against drug-resistant HBV mutants with EC50s of 2.403-3.273 μM. DVR-01 can be used for the research of HBV infection and related diseases.
More description
DC72982 SAG-524
SAG-524 (SAG524) is a potent and orally bioavailable small molecule inhibitor of HBV replication, reduces HBsAg and HBV-DNA (IC50 = 0.92 nM and 1.4 nM) by destabilizing HBV-RNA.
More description
DC72981 Neracorvir
Neracorvir is a potent anti-HBV agent, targets HBV surface antigen.
More description
DC72980 E-CFCP
E-CFCP is a novel long-acting nucleotide reverse transcriptase inhibitor (NRTI) against HBV, shows potent activity against HBV WTD1 and HBV WTC2 with IC50 of 1.8 and 0.7 nM, respectively.
More description
DC11296 GLP-26 Featured
GLP-26 is a novel potent HBV capsid modulator that reduces secreted HBeAg in HepNTCPDL cells transfected with HBV wild type with EC50 of 0.7 uM.
More description
DC47259 Inarigivir ammonium Featured
Inarigivir (ORI-9020) ammonium is a dinucleotide antiviral drug which can significantly reduce liver HBV DNA in transgenic mice expressing hepatitis B virus. Inarigivir (ORI-9020) act as an RIG-I agonist to activate cellular innate immune responses.
More description
DC10882 JNJ-632 Featured
JNJ-632 is a novel and potent inhibitor of HBV replication in vitro across genotypes A-D.
More description

Customized Consultation X

Your information is safe with us. * Required Fields.

Your name
Company
Email
Procuct Name
Cat. No.
Remark
Verification code
Please fill out the characters in the picture
X