To enhance service speed and avoid tariff delays, we've opened a US warehouse. All US orders ship directly from our US facility.
| Cat. No. | Product Name | Field of Application | Chemical Structure |
|---|---|---|---|
| DC72979 | DF-006 |
DF-006 is a small molecule, orally active Alpha-kinase 1 (ALPK1) agonist, activates ALPK1 and stimulates host innate immunity locally in liver, DF-006 enacts potent anti-HBV responses in mouse models of HBV and in primary human hepatocytes.
More description
|
|
| DC79553 | Di-Val-L-dC |
Di-Val-L-dC, a prodrug of L-deoxycytidine, is a selective and specific anti-HBV agent.
More description
|
|
| DC79313 | KR-26556 |
KR-26556 is a sulfonamide type hepatitis B virus (HBV) capsid assembly regulator. KR-26556 exhibits anti-HBV activity with an EC50 of 0.04 μM. KR-26556 has favorable safety characteristics. KR-26556 can be used for research on chronic hepatitis B.
More description
|
|
| DC79183 | CCC-0975 |
CCC-0975 is a hepatitis B virus (HBV) inhibitor (EC50=10 μM). CCC-0975 interferes with the conversion of relaxed circular DNA (rcDNA) to cccDNA, synchronously reducing cccDNA and its precursor deproteinized rcDNA (DP-rcDNA) without promoting their intracellular degradation. CCC-0975 is promising for research of chronic hepatitis B.
More description
|
|
| DC79100 | AT-61 |
AT-61 is a non nucleoside HBV replication inhibitor. AT-61 prevents the capsid formation of pre genomic RNA, resulting in the production of empty capsids. AT-61 has the activity of drug-resistant mutant strains. AT-61 can be used for research on hepatitis B virus infection.
More description
|
|
| DC79013 | VNRX-9945 |
VNRX-9945 is a potent, broadly and orally active HBV CAM (capsid assembly modulator) with an EC50 of 2.6 nM. VNRX-9945 exhibits excellent and broad antiviral activity against multiple HBV genotypes in vitro, along with favorable pharmacokinetic profiles across multiple species. VNRX-9945 demonstrates robust antiviral efficacy in the adeno-associated virus mice models of HBV (AAV-HBV) infection.
More description
|
|
| DC78702 | ALG-001075 |
ALG-001075, a capsid assembly modulator (CAM), is an orally active HBV inhibitor. ALG-001075 effectively blocks not only HBV DNA production but also extracellular HBsAg/HBeAg and intracellular HBV RNA in primary human hepatocytes. ALG-001075 shows pronounced reductions of circulating HBV DNA in the AAV-HBV mouse model. ALG-001075 can be used for the study of Chronic hepatitis B (CHB).
More description
|
|
| DC77993 | Tomligisiran |
Tomligisiran is a siRNA in JNJ-3989 (JNJ-73763989). JNJ-3989 is comprised of 2 siRNAs (Daplusiran and Tomligisiran), that target hepatitis B virus (HBV) mRNAs for degradation, thereby inhibiting HBV replication.
More description
|
|
| DC77992 | Tomligisiran sodium |
Tomligisiran sodium is a siRNA in JNJ-3989 (JNJ-73763989). JNJ-3989 is comprised of 2 siRNAs (Daplusiran and Tomligisiran), that target hepatitis B virus (HBV) mRNAs for degradation, thereby inhibiting HBV replication.
More description
|
|
| DC77962 | Ozisiran |
Ozisiran, a siRNA, is a hepatitis B virus (HBV) RNA transcript reducer with antiviral activity.
More description
|
|
| DC77961 | Ozisiran sodium |
Ozisiran sodium, a siRNA, is a hepatitis B virus (HBV) RNA transcript reducer with antiviral activity.
More description
|
|
| DC77884 | Daplusiran |
Daplusiran is a siRNA in JNJ-3989 (JNJ-73763989). JNJ-3989 is comprised of 2 siRNAs (Daplusiran and Tomligisiran), that target hepatitis B virus (HBV) mRNAs for degradation, thereby inhibiting HBV replication.
More description
|
|
| DC77883 | Daplusiran sodium |
Daplusiran sodium is a siRNA in JNJ-3989 (JNJ-73763989). JNJ-3989 is comprised of 2 siRNAs (Daplusiran and Tomligisiran), that target hepatitis B virus (HBV) mRNAs for degradation, thereby inhibiting HBV replication.
More description
|
|
| DC76051 | Rapavir |
Rapavir (JH-B10) is a selective and potent sodium taurocholate cotransporting polypeptide (NTCP) inhibitor with an IC50 value of 1.8 nM for the uptake of taurocholic acid-d4 (TCA-d4). Rapavir exerts antiviral activity by directly binding to NTCP and blocking the entry of the virus into cells during the HBV infection phase. Rapavir is promising for research of HBV infections.
More description
|
|
| DC76050 | Morphothiadin mesylate |
Morphothiadin (GLS4) mesylate is a potent inhibitor of wild-type and Adefovir-resistant HBV replication with an IC50 value of 12 nM.
More description
|
|
| DC76049 | KR019 |
KR019 is a potent HBV capsid assembly modulator, exhibits potent antiviral activity in HBV-replicating cells. KR019 binds to the hydrophobic pocket at the core protein dimer-dimer interface, misdirecting capsid assembly into genome-free capsids and thereby inhibiting viral replication.
More description
|
|
| DC76048 | Destruxin B2 |
Destruxin B2 (compound 5) is a natural depsipeptide that can be inhibits hepatitis B surface antigen (HBsAg) secretion in Hep3B cells with an IC50 1.30 μM.
More description
|
|
| DC76047 | BA-AZT1 |
BA-AZT1 is the inhibitor for HBV polymerase and sodium taurocholate cotransporting polypeptide (NTCP). BA-AZT1 inhibits the secretion of viral capsid protein HBsAg and HBeAg with IC50 of 0.65 µM and 13.42 µM, inhibits the HBV DNA replication with an IC50 of 0.70 µM.
More description
|
|
| DC76046 | ALG-000184 |
ALG-000184, a prodrug of the potent Hhepatitis B virus (HBV) capsid assembly modulator ALG-001075, has the potential for the research of HBV infection research.
More description
|
|
| DC76045 | AIC263282 |
AIC263282 is a potent Hepatitis B Virus (HBV) capsid assembly modulator with an EC50 of 3.8 nM. AIC263282 shows an IC50 of 61 nM for hERG. AIC263282 exhibits activity against viral replication and hepatitis B surface antigen (HBsAG) on primary human hepatocytes.
More description
|
|
| DC71481 | Bepirovirsen Featured |
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
More description
|
|
| DC47062 | Bersacapavir Featured |
Bersacapavir is a novel Hepatitis B Virus capsid assembly modulator.
More description
|
|
| DC72983 | ZINC20451377 Featured |
ZINC20451377 is a small molecule that binds to hepatitis B surface antigen (HBsAg) with high affinity (Kd=65.3 nM), reduces HBsAg levels and HBV virion secretion in cell culture model for HBV.
More description
|
|
| DC72290 | DVR-01 Featured |
DVR-01 is a HBV inhibitor with EC50 values of 1.7 and 1.6 μM in AML12HBV10 and HepDES19 cells, respectively. DVR-01 shows antiviral activity against drug-resistant HBV mutants with EC50s of 2.403-3.273 μM. DVR-01 can be used for the research of HBV infection and related diseases.
More description
|
|
| DC72982 | SAG-524 |
SAG-524 (SAG524) is a potent and orally bioavailable small molecule inhibitor of HBV replication, reduces HBsAg and HBV-DNA (IC50 = 0.92 nM and 1.4 nM) by destabilizing HBV-RNA.
More description
|
|
| DC72981 | Neracorvir |
Neracorvir is a potent anti-HBV agent, targets HBV surface antigen.
More description
|
|
| DC72980 | E-CFCP |
E-CFCP is a novel long-acting nucleotide reverse transcriptase inhibitor (NRTI) against HBV, shows potent activity against HBV WTD1 and HBV WTC2 with IC50 of 1.8 and 0.7 nM, respectively.
More description
|
|
| DC11296 | GLP-26 Featured |
GLP-26 is a novel potent HBV capsid modulator that reduces secreted HBeAg in HepNTCPDL cells transfected with HBV wild type with EC50 of 0.7 uM.
More description
|
|
| DC47259 | Inarigivir ammonium Featured |
Inarigivir (ORI-9020) ammonium is a dinucleotide antiviral drug which can significantly reduce liver HBV DNA in transgenic mice expressing hepatitis B virus. Inarigivir (ORI-9020) act as an RIG-I agonist to activate cellular innate immune responses.
More description
|
|
| DC10882 | JNJ-632 Featured |
JNJ-632 is a novel and potent inhibitor of HBV replication in vitro across genotypes A-D.
More description
|
|