C29 is a potential TLR2 inhibitor.

GSK2245035 is a highly potent and selective intranasal Toll-Like receptor 7 (TLR7) agonist with preferential Type-1 interferon (IFN)-stimulating properties. GSK2245035 has pEC50s of 9.3 and 6.5 for IFNα and TFNα. GSK2245035 effectively suppresses allergen-induced Th2 cytokine production in human peripheral blood cell cultures. GSK2245035 is used for asthma.

α-Galactosylceramide (α-GalCer) is a synthetic glycolipid with antitumorial and immunostimulatory. α-Galactosylceramide is a very potent NKT cell agonist and binds effectively to CD1d. The complex of α-Galactosylceramide plus CD1d binds the NKT cell TCR (T cell antigen receptor).

QS-21, an immunostimulatory saponin, could be used as a potent vaccine adjuvant. QS-21 stimulates Th2 humoral and Th1 cell-mediated immune responses through action on antigen presenting cells (APCs) and T cells. QS-21 can activate the NLRP3 inflammasome with subsequent release of caspase-1 dependent cytokines, IL-1β and IL-18[1][2][3].

Venetoclax (ABT-199; GDC-0199) is a highly selective, orally bioavailable small-molecule inhibitor of Bcl-2, exhibiting sub-nanomolar binding affinity with a Ki of less than 0.01 nM. This compound has been demonstrated to induce autophagy, highlighting its role in modulating programmed cell death pathways. In vitro studies reveal that Venetoclax exhibits potent cytotoxic activity against FL5.12-BCL-2 cells, with an EC50 of 4 nM, while showing markedly reduced efficacy against FL5.12-BCL-XL cells (EC50 = 261 nM), underscoring its selectivity for Bcl-2 over Bcl-XL. The selectivity of Venetoclax is further corroborated in cellular mammalian two-hybrid assays, where it effectively disrupts BCL-2-BIM protein-protein interactions with an EC50 of 3 nM. In contrast, it demonstrates significantly weaker activity against BCL-XL-BCL-XS and MCL-1-NOXA complexes, with EC50 values of 2.2 μM, reinforcing its specificity for Bcl-2-dependent apoptotic regulation. In vivo efficacy studies utilizing xenograft models derived from RS4;11 cells, a representative model of acute lymphoblastic leukemia (ALL), demonstrate that a single oral dose of Venetoclax (12.5 mg/kg) achieves a maximal tumor growth inhibition (TGImax) of 47% (P < 0.001) and a tumor growth delay (TGD) of 26% (P < 0.05). These results indicate robust anti-tumor activity in a Bcl-2-dependent malignancy.

Monophosphoryl lipid A (Glucopyranosyl lipid A) is a toll-like receptor 4 agonist. Monophosphoryl lipid A is derived from the cell wall of nonpathogenic Salmonella. Monophosphoryl lipid A can be used for the research of immunization and vaccine.

Polyinosinic-polycytidylic acid (Poly(I:C)) sodium is a synthetic analog of double-stranded RNA and an agonist of toll-like receptor 3 (TLR3) and retinoic acid inducible gene I (RIG-I)-like receptors (RIG-I and MDA5). Polyinosinic-polycytidylic acid sodium can be used as a vaccine adjuvant to enhance innate and adaptive immune responses, and to alter the tumor microenvironment. Polyinosinic-polycytidylic acid sodium can directly trigger cancer cells to undergo apoptosis.

Cefonicid Sodium is the sodium salt form of cefonicid, a semisynthetic second-generation broadspectrum cephalosporin with antibacterial activity that inhibits the formation of the bacterial cell wall. Cefonicid binds to and inactivates penicillin-binding proteins (PBPs) located on the inner membrane of the bacterial cell wall. PBPs are enzymes involved in the terminal stages of assembling the bacterial cell wall and in reshaping the cell wall during growth and division. Inactivation of PBPs interferes with the cross-linkage of peptidoglycan chains necessary for bacterial cell wall strength and rigidity. This results in the weakening of the bacterial cell wall and causes cell lysis.

Benralizumab (MEDI-563) is an interleukin-5 receptor α (IL-5Rα)-directed cytolytic monoclonal antibody that induces direct, rapid and nearly complete depletion of eosinophils via enhanced antibody-dependent cell-mediated cytotoxicity. Benralizumab can be used for severe eosinophilic asthma.

Dupilumab (REGN-668) is a fully human mAb to IL-4 receptor α (IL-4Rα) that inhibits both IL-4 and IL-13 signaling, markedly improved moderate-to-severe atopic dermatitis.

S6821 (S 6821) is a potent and selective antagonist of the bitter taste receptor TAS2R8, exhibiting an IC50 value of 21 nM. It demonstrates high selectivity across a panel of 16 TAS2Rs, effectively reduces the bitterness of coffee, and shows an excellent safety profile.

GGsTop (Nahlsgen) is a potent, non-toxic, highly selective and irreversible γ-GGT inhibitor, with a Ki of 170 μM for Human GGT. GGsTop shows a pKa of 9.71, also exhibits Kons of 150 and 51 M-1 s-1 against E.coli GGT and human GGT, respectively. GGsTop protects hepatic ischemia-reperfusion injury in rat model.

RA190, a bis-benzylidine piperidon, inhibits proteasome function by covalently binding to cysteine 88 of ubiquitin receptor RPN13.

SNDX-5613 is a potent and selective inhibitor of menin-MLL binding with a Ki of 0.15 nM. SNDX-5613 shows anti-proliferative activity against multiple cell lines harboring MLLr translocations (MV4;11, RS4;11, MOLM-13, KOPN-8) with IC50 values ranging from 10-20 nM.

DSPE-glutaric acid is a lipid. DSPE-glutaric acid can be used for the research of various biochemical.

DSPE-N3 is a lipid. DSPE-N3 can be used for the research of various biochemical.

AS408 is a negative allosteric modulator of the β2-adrenergic receptor (β2AR) for both G-protein activation and arrestin recruitment (pKB=6.8, [35S]GTPγS binding assays), binds to a pocket formed by the membrane-facing surface of TM3 and TM5.

Gartisertib (VX-803) is an ATP-competitive, orally active, and selective ATR inhibitor, with a Ki of <150 pM. Gartisertib potently inhibits ATR-driven phosphorylated checkpoint kinase-1 (Chk1) phosphorylation with an IC50 of 8 nM. Antitumor activity.

(Rac)-SNC80 is a racemate of SNC80. SNC80 (NIH 10815) is a potent, highly selective and non-peptide δ-opioid receptor agonist with a Ki of 1.78 nM and an IC50 of 2.73 nM. SNC80 shows antinociceptive, antihyperalgesic and antidepressant‐like effects. SNC80 has the potential for multiple headache disorders treatment.

SNC80 (NIH 10815) is a potent, highly selective and non-peptide δ-opioid receptor agonist with a Ki of 1.78 nM and an IC50 of 2.73 nM. SNC80 also selectively activates μ-δ heteromer in HEK293 cells with an EC50 of 52.8 nM. SNC80 shows antinociceptive, antihyperalgesic and antidepressant‐like effects. SNC80 has the potential for multiple headache disorders treatment.

DPPG sodium (1,2-Dipalmitoyl-sn-glycero-3-PG sodium) is a phospholipid containing the long-chain(16:0) palmitic acid inserted at the sn-1 and sn-2 positions. DPPG sodium is used in the generation of micelles, liposomes and other types of artificial membranes.

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

Tofersen (BIIB067) is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen can be used for the research of amyotrophic lateral sclerosis (ALS).

Miravirsen (SPC-3649), a β-d-oxy-locked nucleic acid-modified phosphorothioate antisense oligonucleotide, inhibit the biogenesis of miR-122. Miravirsen (SPC-3649) is used in the study for HCV infections.

PT1 is an activator of AMP-activated protein kinase (AMPK) that directly activates the inactive truncated forms of AMPK monomers α1335, α1394, and α2398 in a dose-dependent manner (EC50s = ~ 8, 8, and 12 µM, respectively).

1,4-DPCA ethyl ester is the ethyl ester of 1,4-DPCA and can inhibit factor inhibiting HIF (FIH).

Reversible, non-ATP competitive inhibitor of mitotic kinesin-like protein 2 (MKLP-2)

ATH686 (ATH-686) is a potent and selective, second-generation inhibitor of mutant FLT3 protein kinase.

FABPs ligand 6 (MF6) is an FABP5 and FABP7 inhibitor with KD values of 874 nM and 20 nM, respectively. FABPs ligand 6 can be used for multiple sclerosis research.

EI1 is a potent and selective small molecule inhibitor of EZH2 with IC50 values of 15 nM and 13 nM for wild type EZH2 and EZH2 Y641F mutant, respectively.