Alternate TextTo enhance service speed and avoid tariff delays, we've opened a US warehouse. All US orders ship directly from our US facility.
Home > Inhibitors & Agonists

Inhibitors & Agonists

You can also try the following methods, and our professionals will serve you Customized Consultation
Cat. No. Product Name Field of Application Chemical Structure
DC20045 GGsTop (Nahlsgen) Featured
GGsTop (Nahlsgen) is a potent, non-toxic, highly selective and irreversible γ-GGT inhibitor, with a Ki of 170 μM for Human GGT. GGsTop shows a pKa of 9.71, also exhibits Kons of 150 and 51 M-1 s-1 against E.coli GGT and human GGT, respectively. GGsTop protects hepatic ischemia-reperfusion injury in rat model.
More description
DC10304 RA190 Featured
RA190, a bis-benzylidine piperidon, inhibits proteasome function by covalently binding to cysteine 88 of ubiquitin receptor RPN13.
More description
DC45758 Revumenib Featured
SNDX-5613 is a potent and selective inhibitor of menin-MLL binding with a Ki of 0.15 nM. SNDX-5613 shows anti-proliferative activity against multiple cell lines harboring MLLr translocations (MV4;11, RS4;11, MOLM-13, KOPN-8) with IC50 values ranging from 10-20 nM.
More description
DC72429 DSPE-glutaric acid Featured
DSPE-glutaric acid is a lipid. DSPE-glutaric acid can be used for the research of various biochemical.
More description
DC72432 DSPE-N3 Featured
DSPE-N3 is a lipid. DSPE-N3 can be used for the research of various biochemical.
More description
DC73377 AS408 Featured
AS408 is a negative allosteric modulator of the β2-adrenergic receptor (β2AR) for both G-protein activation and arrestin recruitment (pKB=6.8, [35S]GTPγS binding assays), binds to a pocket formed by the membrane-facing surface of TM3 and TM5.
More description
DC39113 Gartisertib Featured
Gartisertib (VX-803) is an ATP-competitive, orally active, and selective ATR inhibitor, with a Ki of <150 pM. Gartisertib potently inhibits ATR-driven phosphorylated checkpoint kinase-1 (Chk1) phosphorylation with an IC50 of 8 nM. Antitumor activity.
More description
DC72634 (Rac)-SNC80
(Rac)-SNC80 is a racemate of SNC80. SNC80 (NIH 10815) is a potent, highly selective and non-peptide δ-opioid receptor agonist with a Ki of 1.78 nM and an IC50 of 2.73 nM. SNC80 shows antinociceptive, antihyperalgesic and antidepressant‐like effects. SNC80 has the potential for multiple headache disorders treatment.
More description
DC22902 SNC-80 Featured
SNC80 (NIH 10815) is a potent, highly selective and non-peptide δ-opioid receptor agonist with a Ki of 1.78 nM and an IC50 of 2.73 nM. SNC80 also selectively activates μ-δ heteromer in HEK293 cells with an EC50 of 52.8 nM. SNC80 shows antinociceptive, antihyperalgesic and antidepressant‐like effects. SNC80 has the potential for multiple headache disorders treatment.
More description
DC49194 DPPG sodium Featured
DPPG sodium (1,2-Dipalmitoyl-sn-glycero-3-PG sodium) is a phospholipid containing the long-chain(16:0) palmitic acid inserted at the sn-1 and sn-2 positions. DPPG sodium is used in the generation of micelles, liposomes and other types of artificial membranes.
More description
DC71481 Bepirovirsen Featured
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
More description
DC47285 Tofersen Featured
Tofersen (BIIB067) is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen can be used for the research of amyotrophic lateral sclerosis (ALS).
More description
DC47291 Miravirsen Featured
Miravirsen (SPC-3649), a β-d-oxy-locked nucleic acid-modified phosphorothioate antisense oligonucleotide, inhibit the biogenesis of miR-122. Miravirsen (SPC-3649) is used in the study for HCV infections.
More description
DC43414 PT1 Featured
PT1 is an activator of AMP-activated protein kinase (AMPK) that directly activates the inactive truncated forms of AMPK monomers α1335, α1394, and α2398 in a dose-dependent manner (EC50s = ~ 8, 8, and 12 µM, respectively).
More description
DC41030 1,4-DPCA ethyl ester Featured
1,4-DPCA ethyl ester is the ethyl ester of 1,4-DPCA and can inhibit factor inhibiting HIF (FIH).
More description
DC43625 Paprotrain Featured
Reversible, non-ATP competitive inhibitor of mitotic kinesin-like protein 2 (MKLP-2)
More description
DC10921 ATH686 Featured
ATH686 (ATH-686) is a potent and selective, second-generation inhibitor of mutant FLT3 protein kinase.
More description
DC71536 FABPs ligand 6 Featured
FABPs ligand 6 (MF6) is an FABP5 and FABP7 inhibitor with KD values of 874 nM and 20 nM, respectively. FABPs ligand 6 can be used for multiple sclerosis research.
More description
DC7930 EI-1 Featured
EI1 is a potent and selective small molecule inhibitor of EZH2 with IC50 values of 15 nM and 13 nM for wild type EZH2 and EZH2 Y641F mutant, respectively.
More description
DC11370 TAK-901 Featured
TAK-901 is a non-selective Aurora kinase inhibitor (IC50s = 3.1, 10, and 4.2 nM for Aurora A, B, and C, respectively).
More description
DC71165 VY-3-135 Featured
VY-3-135 is an orally active, selective acetyl-CoA synthetase 2 (ACSS2) inhibitor with an IC50 value of 44 nM. VY-3-135 displayes no inhibitory activity towards recombinant human ACSS1 or ACSS3. VY-3-135 potently inhibits ACSS2 dependent fatty acid metabolism but has no effect on gene expression in tumors. VY-3-135 inhibits triple negative breast cancer (TNBC) tumor growth in mouse ACSS2high but not ACSS2low tumors models.
More description
A127 Rovalpituzumab Biosimilar (Anti-DLL3 Reference Antibody) Featured
Rovalpituzumab is a humanized monoclonal antibody against delta-like protein 3 (DLL3). Rovalpituzumab can be used in the synthesis of antibody-drug conjugate (ADC), Rovalpituzumab Tesirine. Rovalpituzumab has activity against small cell lung cancer (SCLC).
More description
A126 Evolocumab Biosimilar (Anti-PCSK9 Reference Antibody) Featured
Evolocumab (AMG 145) is a human monoclonal antibody that inhibits PCSK9. Evolocumab binds to the circulating PCSK9 protein, inhibiting it from binding to the LDLR. Evolocumab can be used for the research of hypercholesterolemia and atherosclerotic cardiovascular diseases.
More description
DC33111 Tesofensine(NS-2330) Featured
Tesofensine (NS-2330) is a triple monoamine reuptake inhibitor inducing a potent inhibition of the re-uptake process in the synaptic cleft of the neurotransmitters dopamine (DA; IC50=6.5 nM), norepinephrine (NE;IC50=1.7 nM), and serotonin (5-HT;IC50=11 nM), and with potentials as an anti-obesity agent. Tesofensine is a CNS acting anti-obesity agent.
More description
DC71975 TriGalNAc CBz Featured
TriGalNAc CBz is a GalNAc derivative and tri-GalNAc is an asialoglycoprotein receptor (ASGPR) ligand. TriGalNAc CBz can be used for mRNA drug delivery as well as lysosomal targeted chimerism (LYTAC) studies.
More description
DCC4967 Sucnr1-in-20 Featured
SUCNR1-IN-2 (Statement 35) is a succinate/succinate receptor 1 inhibitor for the study of neurodegenerative diseases such as neuroinflammation.
More description
DC34484 ATC0175 Featured
ATC0175 is a novel nonpeptidic and orally active melanin-concentrating hormone receptor 1 (MCHR1) antagonist.
More description
DC34410 CX-6258 Hydrochloride Featured
CX-6258 HCl is a potent, selective, and orally efficacious pan-Pim kinases inhibitor.
More description
DC74090 NCGC00378430 Featured
NCGC00378430 (Compound 8430) is a novel small molecule compound that reduces the SIX1/EYA2 interaction in vitro with IC50 of 52 uM in the Alphascreen assay.
More description
DC47422 p-SCN-Bn-DOTA Featured
p-SCN-Bn-DOTA is a bifunctional chelating agent. p-SCN-Bn-DOTA can simultaneously chelate radionuclides and link monoclonal antibody for radioimmunotherapy of tumor.
More description

Customized Consultation X

Your information is safe with us. * Required Fields.

Your name
Company
Email
Procuct Name
Cat. No.
Remark
Verification code
Please fill out the characters in the picture
X