GGsTop (Nahlsgen) is a potent, non-toxic, highly selective and irreversible γ-GGT inhibitor, with a Ki of 170 μM for Human GGT. GGsTop shows a pKa of 9.71, also exhibits Kons of 150 and 51 M-1 s-1 against E.coli GGT and human GGT, respectively. GGsTop protects hepatic ischemia-reperfusion injury in rat model.

RA190, a bis-benzylidine piperidon, inhibits proteasome function by covalently binding to cysteine 88 of ubiquitin receptor RPN13.

SNDX-5613 is a potent and selective inhibitor of menin-MLL binding with a Ki of 0.15 nM. SNDX-5613 shows anti-proliferative activity against multiple cell lines harboring MLLr translocations (MV4;11, RS4;11, MOLM-13, KOPN-8) with IC50 values ranging from 10-20 nM.

DSPE-glutaric acid is a lipid. DSPE-glutaric acid can be used for the research of various biochemical.

DSPE-N3 is a lipid. DSPE-N3 can be used for the research of various biochemical.

AS408 is a negative allosteric modulator of the β2-adrenergic receptor (β2AR) for both G-protein activation and arrestin recruitment (pKB=6.8, [35S]GTPγS binding assays), binds to a pocket formed by the membrane-facing surface of TM3 and TM5.

Gartisertib (VX-803) is an ATP-competitive, orally active, and selective ATR inhibitor, with a Ki of <150 pM. Gartisertib potently inhibits ATR-driven phosphorylated checkpoint kinase-1 (Chk1) phosphorylation with an IC50 of 8 nM. Antitumor activity.

(Rac)-SNC80 is a racemate of SNC80. SNC80 (NIH 10815) is a potent, highly selective and non-peptide δ-opioid receptor agonist with a Ki of 1.78 nM and an IC50 of 2.73 nM. SNC80 shows antinociceptive, antihyperalgesic and antidepressant‐like effects. SNC80 has the potential for multiple headache disorders treatment.

SNC80 (NIH 10815) is a potent, highly selective and non-peptide δ-opioid receptor agonist with a Ki of 1.78 nM and an IC50 of 2.73 nM. SNC80 also selectively activates μ-δ heteromer in HEK293 cells with an EC50 of 52.8 nM. SNC80 shows antinociceptive, antihyperalgesic and antidepressant‐like effects. SNC80 has the potential for multiple headache disorders treatment.

DPPG sodium (1,2-Dipalmitoyl-sn-glycero-3-PG sodium) is a phospholipid containing the long-chain(16:0) palmitic acid inserted at the sn-1 and sn-2 positions. DPPG sodium is used in the generation of micelles, liposomes and other types of artificial membranes.

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

Tofersen (BIIB067) is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen can be used for the research of amyotrophic lateral sclerosis (ALS).

Miravirsen (SPC-3649), a β-d-oxy-locked nucleic acid-modified phosphorothioate antisense oligonucleotide, inhibit the biogenesis of miR-122. Miravirsen (SPC-3649) is used in the study for HCV infections.

PT1 is an activator of AMP-activated protein kinase (AMPK) that directly activates the inactive truncated forms of AMPK monomers α1335, α1394, and α2398 in a dose-dependent manner (EC50s = ~ 8, 8, and 12 µM, respectively).

1,4-DPCA ethyl ester is the ethyl ester of 1,4-DPCA and can inhibit factor inhibiting HIF (FIH).

Reversible, non-ATP competitive inhibitor of mitotic kinesin-like protein 2 (MKLP-2)

ATH686 (ATH-686) is a potent and selective, second-generation inhibitor of mutant FLT3 protein kinase.

FABPs ligand 6 (MF6) is an FABP5 and FABP7 inhibitor with KD values of 874 nM and 20 nM, respectively. FABPs ligand 6 can be used for multiple sclerosis research.

EI1 is a potent and selective small molecule inhibitor of EZH2 with IC50 values of 15 nM and 13 nM for wild type EZH2 and EZH2 Y641F mutant, respectively.

TAK-901 is a non-selective Aurora kinase inhibitor (IC50s = 3.1, 10, and 4.2 nM for Aurora A, B, and C, respectively).

VY-3-135 is an orally active, selective acetyl-CoA synthetase 2 (ACSS2) inhibitor with an IC50 value of 44 nM. VY-3-135 displayes no inhibitory activity towards recombinant human ACSS1 or ACSS3. VY-3-135 potently inhibits ACSS2 dependent fatty acid metabolism but has no effect on gene expression in tumors. VY-3-135 inhibits triple negative breast cancer (TNBC) tumor growth in mouse ACSS2high but not ACSS2low tumors models.

Rovalpituzumab is a humanized monoclonal antibody against delta-like protein 3 (DLL3). Rovalpituzumab can be used in the synthesis of antibody-drug conjugate (ADC), Rovalpituzumab Tesirine. Rovalpituzumab has activity against small cell lung cancer (SCLC).

Evolocumab (AMG 145) is a human monoclonal antibody that inhibits PCSK9. Evolocumab binds to the circulating PCSK9 protein, inhibiting it from binding to the LDLR. Evolocumab can be used for the research of hypercholesterolemia and atherosclerotic cardiovascular diseases.

Tesofensine (NS-2330) is a triple monoamine reuptake inhibitor inducing a potent inhibition of the re-uptake process in the synaptic cleft of the neurotransmitters dopamine (DA; IC50=6.5 nM), norepinephrine (NE;IC50=1.7 nM), and serotonin (5-HT;IC50=11 nM), and with potentials as an anti-obesity agent. Tesofensine is a CNS acting anti-obesity agent.

TriGalNAc CBz is a GalNAc derivative and tri-GalNAc is an asialoglycoprotein receptor (ASGPR) ligand. TriGalNAc CBz can be used for mRNA drug delivery as well as lysosomal targeted chimerism (LYTAC) studies.

SUCNR1-IN-2 (Statement 35) is a succinate/succinate receptor 1 inhibitor for the study of neurodegenerative diseases such as neuroinflammation.

ATC0175 is a novel nonpeptidic and orally active melanin-concentrating hormone receptor 1 (MCHR1) antagonist.

CX-6258 HCl is a potent, selective, and orally efficacious pan-Pim kinases inhibitor.

NCGC00378430 (Compound 8430) is a novel small molecule compound that reduces the SIX1/EYA2 interaction in vitro with IC50 of 52 uM in the Alphascreen assay.

p-SCN-Bn-DOTA is a bifunctional chelating agent. p-SCN-Bn-DOTA can simultaneously chelate radionuclides and link monoclonal antibody for radioimmunotherapy of tumor.