98N12-5 is an ionizable cationic lipid. It has been used in combination with other lipids in the generation of lipid nanoparticles (LNPs). LNPs containing 98N12-5 and encapsulating proprotein convertase subtilisin kexin type 9 (PCSK9) siRNA selectively accumulate in the liver and reduce total serum cholesterol levels in mice and rats and serum LDL levels in cynomolgus monkeys.

490BP-C14 is a bisphosphonate lipid-like material for mRNA delivery. 490BP-C14 LPNs could enhance mRNA expression and localization in the bone microenvironment, which overcomes biological barriers to deliver mRNA therapeutics.

CL4H6 is a pH-sensitive cationic lipid. CL4H6 is the main component of lipid nanoparticles (LNPs), which can be used to target and deliver siRNA, and induces a potent gene-silencing response[1][2].

14:0 DAP (1,2-dimyristoyl-3-dimethylammonium-propane ) is a cationic lipid that can be used for drug delivery.

EDMPC, a cationic lipid, has an enhanced ability to deliver DNA to pulmonary tissues. EDMPC mediates intralobar DNA delivery to rodents.

Fluorescent DOTAP, a cationic lipid, can be used for the research of nucleic acid and protein delivery.

SQDG is a glycolipid that possesses sugar moieties in their head groups. SQDG is a membrane lipid that can be used to investigate the effects of structural lipid in LNP formulations.

Transfectam is a cationic lipid able to interact with DNA to form complexes that mediate efficient gene transfer into various eukaryotic cells.

DSPE-PEG-MAL is one of the reactive phospholipid PEG reagents that can react with sulfhydryl group (mercaptan, -SH). DSPE (1, 2-distearyl-Sn-glycerol 3-phosphate ethanolamine) is a highly hydrophobic saturated 18C phospholipid.

Cu-free click chemistry with readily synthesized biarylazacyclooctynones. The reaction of azides with strained alkynes, such as cyclooctynes, readily forms a triazole product without the need for a toxic catalyst.

YSK 05 is a pH-sensitive cationic lipid. YSK 05 improves the intracellular trafficking of non-viral vectors. YSK 05-MEND shows significantly good gene silencing activity and hemolytic activity. YSK 05 overcomes the suppression of endosomal escape by PEGylation. YSK 05 effectively enhances siRNA delivery both in vitro and in vivo.

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

TCL053 is an ionizable amino lipid.1 It has been used in the generation of lipid nanoparticles (LNPs) and has a pKa value of 6.8. LNPs containing TCL053 and encapsulating mRNA encoding the Cas9 nuclease, in combination with LNPs containing TCL053 and encapsulating single-guide RNA (sgRNA) targeting the Rosa26 locus, have been used to induce CRISPR-mediated gene editing in the mouse gastrocnemius muscle.TCL053 is an ionizable lipid that has received FDA approval for preparing mRNA vaccines. It is a three-tailed ionizable lipid to overcome the disadvantage of nonrepeatable administration of AAV vectors. In addition, combined with limb perfusion administration, TCL053 iLNPs could transiently deliver CRISPR-Cas9 mRNA and sgRNA to multiple muscle tissues, reducing immunogenicity and increasing the safety of iLNPs. It is great progress for treating Duchenne muscular dystrophy and other diseases that require multiple doses.

NT1-O14B is a tryptamine-containing cationic lipidoid.1 It has been used in combination with other lipids in the formation of lipid nanoparticles (LNPs). Intravenous administration of LNPs containing NT1-O14B and encapsulating antisense nucleotides against tau decreases tau brain levels in mice.

N-[1-(2,3-Dioleyloxy)propyl]-N,N,N-trimethylammonium (DOTMA) is a cationic lipid.It has been used as a component in liposomes that can be used to encapsulate siRNA, microRNAs, and oligonucleotides and for gene transfection in vitro.

Lipid 29 is an ionizable amino lipid (pKa = 6.91) that has been used in combination with other lipids in the formation of lipid nanoparticles (LNPs).Administration of human erythropoietin (EPO) mRNA in lipid 29-containing LNPs increases serum EPO levels in mice.

DOSPA is a cationic lipid. The formulation of DNA with DOSPA is a very promising transfection system.

Vaxfectin is a cationic lipid-based adjuvant that can be used for plasmid DNA- and protein-based vaccines.

Dlin-MeOH is a lipid product for use in drug delivery systems.

Dioctadecylamine (DODA) is a secondary amine that has been shown to self-organize in plate-like structures in aqueous solution. Dioctadecylamine exhibits sufficiently hydrophobic properties of nanoparticles and good dispersibility in nonpolar solvent. Dioctadecylamine does not form a monolayer above pH 3.9.

DOIC is a cationic lipid that can be used for RNA vaccines.

Ionizable lipid A6 (di(dec-3-yn-1-yl) 9-((4-(dimethylamino) butanoyl)oxy) heptadecanedioate) was developed by modifying the backbone structure of Dlin-MC3-DMA through introducing alkynyl and ester groups into the lipid tails. Alkyne lipid A6 demonstrated a significant improvement in transfection efficiency (~8.5, ~2.0, and ~2.5-fold higher than the original MC3, C12-200 and cKK-E12 containing LNPs, respectively).The performance of the A6 coprepared into iLNPs with other amine-containing lipid materials (cKKE12) was evaluated, and the molar ratio of the formulation was changed to 35:16.0:46.5:2.5 (A6/cKKE12: DOPE: Chol: PEG). The results showed that these formulations synergistically facilitated more effective mRNA delivery and improved tolerability following single and repeated dosing. It was confirmed that albumin-associated macrophage phagocytosis and endocytosis is an apolipoprotein-independent cellular internalization pathway of iLNPs in the liver. According to the fusion kinetics, the lipids with highfrequency tail protrusion and high lateral diffusion coefficient can perturb and trigger membrane sprouting, which in turn promotes membrane fusion. The application of iLNPs with those lipids (such as A6) may be an effective method to further enhance the release of mRNA in vivo.