DLinDMA is a key lipid component of stable nucleic acid lipid particles as a benchmark.

DLin-KC2-DMA is 100-fold and 1000-fold more potent, respectively, in silencing of a hepatic gene (Factor VII) in comparison to the previous generation lipid DLin-DMA.

LysoPC(14:0/0:0) is a lysophospholipid (LyP). It is a monoglycerophospholipid in which a phosphorylcholine moiety occupies a glycerol substitution site.

NAV 2729 (NAV2729) is a chemical potentiator for mRNA-LNPs, increasing the delivery efficiencies of mRNA-LNPs in vitro and in vivo. NAV 2729 (NAV2729) is a novel, direct and selective small molecule inhibitor of small GTPase ARF6 with IC50 of 1.5 uM in nucleotide exchange assays.

SH-BC-893 is a water-soluble, orally bioavailable synthetic sphingolipid that triggers nutrient transporter internalization and also blocks lysosome-dependent nutrient generation pathways in cancer cells, activates protein phosphatase 2A (PP2A), leading to mislocalization of the lipid kinase PIKfyve; selectively kills cells expressing an activated form of the anabolic oncogene Ras in vitro and in vivo.SH-BC-893, increases the activity of antisense oligonucleotides (ASOs) and small interfering RNAs (siRNAs) up to 200-fold in vitro without permeabilizing endosomes. SH-BC-893 treatment trapped endocytosed oligonucleotides within extra-lysosomal compartments thought to be more permeable due to frequent membrane fission and fusion events. Simultaneous disruption of ARF6-dependent endocytic recycling and PIKfyve-dependent lysosomal fusion was necessary and sufficient for SH-BC-893 to increase non-lysosomal oligonucleotide levels and enhance their activity. In mice, oral administration of SH-BC-893 increased ASO potency in the liver by 15-fold without toxicity. More importantly, SH-BC-893 enabled target RNA knockdown in the CNS and lungs of mice treated subcutaneously with cholesterol-functionalized duplexed oligonucleotides or unmodified ASOs, respectively. Together, these results establish the feasibility of using a small molecule that disrupts endolysosomal trafficking to improve the activity of oligonucleotides in extrahepatic tissues.

D-Lin-MC3-DMA(MC3) is the most potent cationic lipid that has been synthesized for Lipid nanoparticles (LNPs) to deliver the siRNA.

LP-01 is an ionizable cationic amino lipid (pKa = ~6.1). It has been used in the generation of lipid nanoparticles (LNPs). LNPs containing LP-01 and encapsulating both Cas9 mRNA and modified single-guide RNA (sgRNA) for the transport protein transthyretin (Ttr) induce gene editing in liver cells in mice in a dose-dependent manner resulting in reduced serum Ttr levels for at least 12 months.

Lipid 5 is an amino lipid that affords efficient mRNA delivery in rodent and primate models. Lipid 5 shows optimal pharmacokinetics and non-toxic side effects.Replacement of the linoleic tail with a primary ester-containing lipid tail (Lipid 5) provids increased expression and optimal tissue clearance. The metabolite identification studies with Lipid 5 indicated that hydrolysis of the primary ester is the first step in the metabolism of the lipid[1].Clearance of Lipid 5 and MC3 from multiple mouse tissues is measured after dosing 0.05 mg/kg mRNA on days 1, 8, and 15 in CD-1 female mice. Liver and spleen have the highest levels of Lipid 5, however, significantly lower levels than MC3. Lipid 5 is detected in plasma, lung, and kidney, but not in heart[1].

Colfosceril Palmitate, also known as 129Y-83 and DPPC, is the primary surface-active agent of natural lung surfactant and the major constituent of exogenous surface replacement preparations. Colfosceril Palmitate is used for the prophylaxis and treatment of neonatal respiratory distress syndrome.

DODMA, also known as MBN 305A is a a cationic lipid containing the unsaturated long-chain (18:1) oleic acid inserted at both the sn-1 and sn-2 positions. It has been used in the composition of lipospomes formulated as stable nucleic acid lipid particles that can encapsulate siRNA or other small molecules to be used for drug delivery

DOPE, also known as 1,2-Dioleoyl-sn-glycero-3-PE or 1,2-DOPE, is a synthetic analog of naturally-occurring PE containing 18:1 fatty acids at the sn-1 and sn-2 positions. 1,2-DOPE can be used as an emulsifier to facilitate DNA-liposome complex transport across membranes. It is used in combination with cationic phospholipids to increase efficiency during DNA transfection studies as a non-viral method of gene delivery.

DODAP, also known as 1,2-Dioleoyl-3-dimethylammonium-propane, is a cationic lipid. It has been used as a component in liposomes that can be used to encapsulate siRNA, immunostimulatory oligodeoxynucleotides, antisense oligonucleotides, or chemotherapeutic agents for in vitro and in vivo delivery.

DOTAP, also known as 1,2-Dioleoyl-3-trimethylammoniumpropane, is a cationic liposome-forming compound used for transfection of DNA, RNA, and other negatively charged molecules into eukaryotic cells. It has been used in gene delivery vectors for gene ther

DOPC, also known as 18:1 (Δ9-Cis) PC, is a phospholipid containing the unsaturated long-chain (18:1) oleic acid inserted at the sn-1 and sn-2 positions. It is commonly used alone, or with other components, in the generation of micelles, liposomes, and other types of artificial membranes.

Lysyllysyllysine is a cationic moietie that may be used in the construction of gene delivery vectors and DNA nanoparticles.

DMG-PEG 2000 is used for the preparation of liposome for siRNA delivery with improved transfection efficiency in vitro. DMG-PEG 2000 is also used for the lipid nanoparticle for an oral plasmid DNA delivery approach in vivo through a facile surface modific

7-Oxotridecanedioic acid is a biodegradable cationic lipid intermediate compound for lipid nanoparticles formation. 7-Oxotridecanedioic acid can be incorporated into a lipid particle for delivering active agents.

NT1-O12B, an endogenous chemical and a neurotransmitter-derived lipidoid (NT-lipidoid), is an effective carrier for enhanced brain delivery of several blood-brain barrier (BBB)-impermeable cargos. Doping NT1-O12B into BBB-impermeable lipid nanoparticles (LNPs) gives the LNPs the ability to cross the BBB. NT-lipidoids formulation not only facilitate cargo crossing of the BBB, but also delivery of the cargo into neuronal cells for functional gene silencing or gene recombination.

ALC-0315 is an ionisable aminolipid that used for mRNA compaction and aids mRNA cellular delivery. ALC-0315 can be used to form lipid nanoparticle (LNP) delivery vehicles.

DSPE-PEG6-Mal is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.

ALC-0159 is a PEG/lipid conjugate (i.e. PEGylated lipid). Formulations containing ALC-0159 have been used in the development of lipid nanoparticles (LNPs) for the delivery of mRNA-based vaccines.

SM-102 is an ionizable amino lipid that has been used in combination with other lipids in the formation of lipid nanoparticles.Administration of luciferase mRNA in SM-102-containing lipid nanoparticles induces hepatic luciferase expression in mice. Formulations containing SM-102 have been used in the development of lipid nanoparticles for delivery of mRNA-based vaccines.

MVL5 is a new Multivalent Cationic Lipid for siRNA Delivery.Improved total gene silencing and Lower non-specific gene silencing,Lower toxicity.

93-O17S is an imidazole-based synthetic lipidoid for in vivo mRNA delivery. Lipid nanoparticles (LNPs) with 93-O17S promotes both the cross-presentation of tumor antigens and the intracellular delivery of cGAMP (STING agonist).

1,2-Dimyristoyl-sn-glycero-3-phosphocholine (DMPC) is a synthetic phospholipid used in liposomes. 1,2-Dimyristoyl-sn-glycero-3-phosphocholine is used for the study of lipid monolayers and bilayers.

C24 is a novel multiprotic ionizable lipid. C24 lipid nanoparticle (LNP) has a multistage protonation behavior resulting in greater endosomal protonation and greater translation compared to the standard reference MC3 LNP. C24 LNP also lower injection site inflammation and higher stability compared to MC3 LNP.

1,2-Distearoyl-sn-glycero-3-PC is a phospholipid containing the saturated long-chain (18:0) stearic acid inserted at the sn-1 and sn-2 positions.

L319 (LIPID 319) is a novel ionizable, biodegradable lipid for delivery of short interfering RNAs (siRNAs). L319-LPN displays rapid elimination with pKa of 6.38 and also shows well tolerated up to 10 mg/kg.

BAMEA-O16B is a disulfide bond-containing ionizable cationic lipid. BAMEA-O16B, a lipid nanoparticle integrated with disulfide bonds, can efficiently deliver Cas9 mRNA and sgRNA into cells while releasing RNA in response to the reductive intracellular environment for genome editing as fast as 24 h post mRNA delivery.

DEPC, also known as DC22:1PC or SJN79954, is a phospholipid containing erucic acid at the sn-1 and sn-2 positions. DEPC is a useful reagent in drug formulation study. It has been used in the study of lipid membranes and to determine the effect of long-chain phospholipids on the secondary structure of human islet amyloid polypeptide (hIAPP).

ATX-126(ATX-0126, 10p) is an ionizable cationic lipid (pKa = 6.38).It has been used in the generation of lipid nanoparticles (LNPs) for the delivery of siRNA. Intravenous administration of LNPs containing ATX-126(ATX-0126, 10p) and encapsulating Factor VII siRNA decrease Factor VII blood levels in mice.

Lipid A9 is an ionizable cationic lipid (pKa = 6.27) that has been used in the generation of lipid nanoparticles (LNPs) for the delivery of mRNA and siRNA in vivo. LNPs containing lipid A9 and encapsulating non-stimulatory siRNA increase plasma levels of chemokine (C-C motif) ligand 2 (CCL2), indicating activation of the innate immune response, and decrease body weight in mice.

tri-GalNAc-COOH is an asialoglycoprotein receptor (ASGPR) ligand that can be used for LYsosome TArgeting Chimera (LYTAC) research.

Nusinersen is an antisense oligonucleotide drug that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein.

Tofersen (BIIB067) is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen can be used for the research of amyotrophic lateral sclerosis (ALS).

Tivanisiran (SYL1001) is a siRNA used for the study of dry eye disease. Tivanisiran was designed to silence transient receptor potential vanilloid 1 (TRPV1).

Remlarsen (MRG-201), a miR-29b mimic, acts a miR-29b agonist. Remlarsen has the potential for preventiong formation of a fibrotic scar or cutaneous fibrosis.

Miravirsen (SPC-3649), a β-d-oxy-locked nucleic acid-modified phosphorothioate antisense oligonucleotide, inhibit the biogenesis of miR-122. Miravirsen (SPC-3649) is used in the study for HCV infections.

Inclisiran (ALN-PCSsc) is a double-stranded small interfering RNA (siRNA) molecule that inhibits the transcription of PCSK-9. Inclisiran can be used for hyperlipidemia and cardiovascular disease (CVD) research.

ARO-AAT is a second-generation RNAi drug. ARO-AAT consistes of a cholesterol-conjugated RNAi trigger (chol-RNAi) to selectively degrade AAT mRNA by RNAi and a melittin-derived peptide conjugated to N-acetylgalactosamine (NAG) formulated as the excipient EX1 to promote endosomal escape of the chol-RNAi in hepatocytes.

Lumasiran (ALN-G01), a siRNA product, reduces hepatic oxalate production by targeting glycolate oxidase. By silencing the gene encoding glycolate oxidase, Lumasiran depletes glycolate oxidase and thereby inhibits the synthesis of oxalate, which is the toxic metabolite that is directly associated with the clinical manifestations of Primary hyperoxaluria type 1 (PH1).

Rovanersen (WVE-120101) is an antisense oligonucleotide that can be used for huntington’s disease research.

C12-200 is a cationic lipid for Lipid NanoParticles as delivery systems for enabling the therapeutic potential of siRNA, mRNA or CRISPR as they exhibit remarkable in vivo potencies at low doses.C12-200 is a common positive control ionizable lipid for exploring new ionizable lipids. C12-200 is an ionizable lipid with five tails. The tri-palmitoyl-Sglyceryl cysteine linked to the pentapeptide (Pam3)-modified C12-200 iLNPs was developed to deliver tumor antigen mRNA for enhancing the mRNA-mediated cancer immunotherapy. The results of the therapeutic evaluation showed that Pam3- modified C12-200 iLNPs could almost inhibit tumor growth in tumor-bearing mice. To improve delivery efficiency, the formulation was optimized to replace the phospholipids from DSPC to DOPE, and the result showed that optimized formulation induced EPO protein expression was seven times that of the initial formulation,[35] and the formulation has been used in the study for mRNA-mediated human α-galactosidase protein replacement therapy in mice and nonhuman primates.

PEG2000-DSPE is used for creating micelles that are able to carry drugs with low solubility.

ssPalmO-Phe(SS-OP) is a self-degradable material for the delivery of oligonucleotides. ssPalmO-Phe is a self-degradable derivative of ssPalm that is self-degraded in the intraparticle space by a specific hydrolytic reaction. ssPalmO-Phe is beneficial for overcoming the plasma/endosomal membrane, LNP-ssPalmO-Phe can be used to deliver both nucleic acids.

C14-4 (C14-494,Lipid B-4,Lipid B4) is a novel ionizable lipid with the highest T-cell transfection efficiency and low cytotoxicity.The C14-4 ionizable lipid has been explored for CAR-T therapy.To screen the excellent formulations for mRNA delivery, a lipid library of 24 ionizable lipids was constructed to make iLNPs, which were used to deliver luciferase mRNA into Jurkat cells.[115] The optimal iLNPs formulation was C14-4 iLNPs (C14-4 ionizable lipid, DOPE, chol, and PEG at a molar ratio of 35%, 16%, 46.5%, and 2.5%) (Figure 6c). The optimal dose of luciferase mRNA for C14-4 iLNPs was 30 ng. Compared with electroporated CAR T cells, the CAR T cells engineered via C14-4 iLNPs showed potent cancer-killing activity when they were cocultured with Nalm-6 acute lymphoblastic leukemia cells. To obtain a safer and more effective CAR mRNA delivery vehicle, the orthogonal design provided 256 potential formulations, and 16 representative iLNPs formulations were evaluated.Through evaluating the safety, delivery efficiency, and transfection efficiency of 16 iLNPs, the formulation B10 (C14-4 ionizable lipid, DOPE, chol, PEG at a molar ratio of 40%, 30%, 25%, and 2.5%) was screened out as the optimal performing formulation. The luciferase expression based on B10 formulation was increased threefold than the initial formulation. Reducing the accumulation and clearance of iLNPs in the liver can increase the expression of CAR mRNA in T cells, further improving the therapeutic effect of CAR-T. Studies have shown that cholesterol analogs can alter the mechanisms of intracellular circulation and enhance the delivery of mRNA, which may be related to the reduced recognition of iLNPs by the Niemann Pick C1 (NPC1) enzyme.The addition of a hydroxyl group to various locations in the cholesterol molecule can alter the binding kinetics between the modified cholesterol and NPC1, and reduced NPC1 recognition of cholesterol. The results showed that replacement of 25% and 50% 7 α-hydroxycholesterol for cholesterol in iLNPs improved mRNA delivery to primary human T cells in vitro by 1.8-fold and twofold, respectively.C14-4 is one of the ionizable lipids to efficiently deliver mRNA to Jurkat cells or primary human T cells. It will effectively promote the development of mRNA delivery by iLNPs for CAR-T therapy.

ATX-002 is a property-tunable lipid for RNA drug delivery.

Genevant CL1 (lipid 10) is a novel ionizable lipid for rna delivery.Lipid 10 rapidly accumulated in the liver within the first hour of dosing (reflecting LNP uptake), but levels then steadily declined over the ensuing 2 weeks period, similar to MC3.Lipid 10 afforded more than double the expression of either approved lipid. We also observed high splenic expression for ALC-0315, which correlated with higher MCP-1 levels.Animals received a single 5 µg IM dose of LNP encapsulating firefly luciferase (fLuc) mRNA. Whole body imaging was performed 6 h later and expression at the injection site quantified. Lipid 10, ALC-0315, and SM-102 showed similar expression at the injection site, all greater than the older generation benchmarks lipids (DLinDMA, KC2, MC3). Lipid 10 and ALC-0315 also showed high expression in the liver, while SM-102 was less, and more similar to MC3.Lipid 10-based LNP reported similar anti-HA IgG titers to MC3 and ALC-0315 (Comirnaty) LNP, and higher than the SM-102 (SpikeVax) LNP composition. MCP-1 levels were generally similar, although the ALC-0315 composition had a significantly higher response at the 5 µg dose. All formulations reported good stability when stored frozen at −80 °C or at 2–8 °C for 1 month.

Arcturus lipid 2(Lipid 2,2 (8,8) 4C CH3,ATX0114 ) is a novel ionizable lipid for mRNA delivery.

PEG2000-C-DMG, a lipid, can be used for the preparation of Onpattro. Onpattro, a hepatically directed investigational RNAi therapeutic agent, harnesses this process to reduce the production of mutant and wild-type transthyretin by targeting the 3′ untranslated region of transthyretin mRNA.

DPPG sodium (1,2-Dipalmitoyl-sn-glycero-3-PG sodium) is a phospholipid containing the long-chain(16:0) palmitic acid inserted at the sn-1 and sn-2 positions. DPPG sodium is used in the generation of micelles, liposomes and other types of artificial membranes.

18:0 DAP can be used to formulate lipid nanoparticles (LNPs), which mRNA is encapsulated in their core.

DOPS-NA is a ubstitute for Phosphoserine/phosphatidylserine. DOPS-NA can be used in lipid mixtures with DOPC and DOPE as effective nontoxic and nonviral DNA vectors.

DLin-K-C3-DMA, a nucleic acid, shows in vivo silencing activity. DLin-K-C3-DMA can be used in the synthesis of nucleic acid-lipid particle to delivery of nucleic acid.

DSPE-PEG-Maleimide, MW 2,000 is a PEG compound with DSPE and maleimide groups. The DSPE-PEGs have been FDA approved for medical applications. The hydrophobic properties of the DSPE allow for the encapsulation and congregation of other hydrophobic drugs. The hydrophilic polyPEG increases the water solubility of the overall compound allowing for the delivery of the drug. Maleimide groups can react with thiol groups between pH 6.5 to 7.5.

TT3 is an ionizable cationic amino lipid that has been used in combination with other lipids in the formation of lipid-like nanoparticles (LLNs). Administration of LLNs containing TT3 and encapsulating mRNA encoding human coagulation Factor IX induces human coagulation Factor IX expression in the plasma of mice.

CKK-E12 is a ionizable lipid in combination with other lipids make up the lipid nanoparticles which are used to deliver RNA-based therapeutics. cKK-E12 was highly selective toward liver parenchymal cell in vivo.Multitail lipids usually have three or more tails and tend to form more cone-shaped structures due to the increase of tail crosssection, which enhances the endosome escape and mRNA delivery efficiency.CKK-E12 is an ionizable lipid with four lipid tails and diketopiperazine core-based head. It has shown excellent efficiency in delivering CRISPR-Cas9 mRNA and sgRNA.cKK-E12 iLNPs encapsulated mRNA was used to investigate the effect of Toll-like receptor 4 (TLR4) on iLNPsmediated mRNA delivery, and it has been demonstrated that the targeting, safety and efficacy of iLNPs are closely related to disease state. In other words, even though iLNP delivers therapeutic mRNA to a given cell type in one disease state, it is not guaranteed to deliver mRNA to the same cell type in another disease. As same as MC3 and C12-200, CKK-E12 is also used to be a positive control ionizable lipid when exploiting new ionizable lipids.

L-343 is an ionizable cationic lipidoid and can be used to synthetic liposomes for systemic delivery of RNAi therapeutics, Pka: 6.34.L343, with its sterically hindered tert-butyl esters, exhibited slower elimination from plasma and higher and more persistent levels in liver compared with L319.

503O13 is a degradable lipid-like compound for siRNA delivery.

5A2-SC8 is a dendrimer for miRNA delivery to late-stage liver tumors with low hepatotoxicity. 5A2-SC8 shows potent EC50 < 0.02 mg/kg (siRNA against FVII (siFVII)) in dose-response experiments, and well tolerated in separate toxicity studies in chronically ill mice bearing MYC-driven tumors. 5A2-SC8 is a degradable lipid-like compound (ester-based dendrimer) for small RNAs delivery.5A2-SC8, was obtained by screening a large library of more than 1500 ester-based dendrimers containing ionizable amino groups, which have three tertiary amine heads and five lipid tails. Based on this library, the in vitro transfection efficiency of different formulations of 5A2-SC8 iLNPs was evaluated, discovering the optimal formulation (5A2-SC8, DOPE, cholesterol, PEG at a molar ratio of 15:15:30:3) of 5A2-SC8 iLNPs for delivering fumarylacetoacetate hydrolase (FAH) mRNA to liver.After the intravenous injection via tail, the model mice of hepatorenal tyrosinemia type I had strong FAH protein expression, which prevented body weight loss and increased the survival rate of hepatorenal tyrosinemia mice . In addition to introducing utility of 5A2-SC8 iLNPs for the therapeutic intervention, the 5A2-SC8 iLNPs containing DOTAP have been used to establish complex mouse models via intravenous injection, including in situ liverspecific cancer model and in situ lung-specific cancer model. Based on this iLNPs delivery system, 5A2-SC8 induced model construction method overcomes the time-consuming and costly disadvantages of traditional animal models establishing methods, including transgenesis and gene engineering in embryonic stem cells.

ZA3-Ep10 is a zwitterionic lipid used in lipid nanoparticles formulation for in vivo RNA delivery and non-viral CRISPR/Cas gene editing.

FTT5 is a lipid-like compound for efficient delivery of long mRNAs in vivo.

246C10 is a synthesized ionizable lipid. 246C10 can be formulated into lipid nanoparticles (LNPs) with dioleoylphosphatidylethanolamine (DOPE), cholesterol, and C16-PEG2000 ceramide (PEG-lipid) as well as mRNA. The lipid nanoparticle formulations can be used for mRNA delivery. To obtain iLNPs that could specifically target liver sinusoidal endothelial cells (LSECs), six different ionizable lipids (241C10 to 246C10) were synthesized by an epoxide ring-opening reaction with piperazine- or piperidine-containing amines. Biodistribution and gene regulation of various iLNPs were assessed in vivo, and the results showed that the 246C10 iLNPs (containing piperazine amine) had the highest luciferase expression in the liver. When further analyzing the 246C10 iLNPs transfection efficiency in different types of liver cells, it was found that tdTomato fluorescence was mainly concentrated in hepatocytes, not in LSECs. Figure 6f shows that 80% of hepatocytes are fluorescent, 40% of LSECs are fluorescent, and 20% of Kupffer cells are fluorescent. Due to the mannose receptor on LSECs, mannose-PEG lipid was introduced into 246C10 iLNPs to alter the distribution of iLNPs in different liver cells. As shown in Figure 6g, tdTomato fluorescence distribution was 15% of hepatocytes, 70% of LSECs, and 15% of Kupffer cells, significantly improved the ability of iLNPs to actively target LSECs. In contrast, this work indirectly shows that the iLNPs with piperazine head lipid are more able to deliver mRNA to the liver and translate the target protein than the iLNPs with piperidine head lipid. It is worth mentioning that the preparation buffer of 246C10 iLNPs could influence the encapsulation efficiency of mRNA. With the addition of sodium chloride in the citrate buffer, the encapsulation efficiency of CRISPR-Cas9 mRNA and sgRNA was increased. These iLNPs were able to treat hemophilia safely, without causing hepatotoxicity, the immune response induced by Cas9 and off-target editing.

1-Palmitoyl-2-oleoyl-sn-glycero-3-phospho-(1'-rac-glycerol) sodium salt is a lipid molecule having one negative charge, which can interact with the positive charges of peptides.

CLinDMA, a cationic lipid, can cause inflammatory response. CLinDMA can be used for the synthesis LNP201. LNP201 is a liposome assembly for systemic delivery of siRNA.

98N12-5 is an ionizable cationic lipid. It has been used in combination with other lipids in the generation of lipid nanoparticles (LNPs). LNPs containing 98N12-5 and encapsulating proprotein convertase subtilisin kexin type 9 (PCSK9) siRNA selectively accumulate in the liver and reduce total serum cholesterol levels in mice and rats and serum LDL levels in cynomolgus monkeys.

490BP-C14 is a bisphosphonate lipid-like material for mRNA delivery. 490BP-C14 LPNs could enhance mRNA expression and localization in the bone microenvironment, which overcomes biological barriers to deliver mRNA therapeutics.

CL4H6 is a pH-sensitive cationic lipid. CL4H6 is the main component of lipid nanoparticles (LNPs), which can be used to target and deliver siRNA, and induces a potent gene-silencing response[1][2].

14:0 DAP (1,2-dimyristoyl-3-dimethylammonium-propane ) is a cationic lipid that can be used for drug delivery.

EDMPC, a cationic lipid, has an enhanced ability to deliver DNA to pulmonary tissues. EDMPC mediates intralobar DNA delivery to rodents.

Fluorescent DOTAP, a cationic lipid, can be used for the research of nucleic acid and protein delivery.

SQDG is a glycolipid that possesses sugar moieties in their head groups. SQDG is a membrane lipid that can be used to investigate the effects of structural lipid in LNP formulations.

Transfectam is a cationic lipid able to interact with DNA to form complexes that mediate efficient gene transfer into various eukaryotic cells.

DSPE-PEG-MAL is one of the reactive phospholipid PEG reagents that can react with sulfhydryl group (mercaptan, -SH). DSPE (1, 2-distearyl-Sn-glycerol 3-phosphate ethanolamine) is a highly hydrophobic saturated 18C phospholipid.

DSPE-PEG-DBCO ammonium is the ammonium salt form of DSPE-PEG-DBCO. DSPE-PEG-DBCO ammonium is utilized in copper-free click chemistry through SPAAC conjugation with an azido-functionalized peptide ligand. DSPE-PEG-DBCO ammonium is applied in drug-delivery and nanoparticle research.

YSK 05 is a pH-sensitive cationic lipid. YSK 05 improves the intracellular trafficking of non-viral vectors. YSK 05-MEND shows significantly good gene silencing activity and hemolytic activity. YSK 05 overcomes the suppression of endosomal escape by PEGylation. YSK 05 effectively enhances siRNA delivery both in vitro and in vivo.

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

TCL053 is an ionizable amino lipid.1 It has been used in the generation of lipid nanoparticles (LNPs) and has a pKa value of 6.8. LNPs containing TCL053 and encapsulating mRNA encoding the Cas9 nuclease, in combination with LNPs containing TCL053 and encapsulating single-guide RNA (sgRNA) targeting the Rosa26 locus, have been used to induce CRISPR-mediated gene editing in the mouse gastrocnemius muscle.TCL053 is an ionizable lipid that has received FDA approval for preparing mRNA vaccines. It is a three-tailed ionizable lipid to overcome the disadvantage of nonrepeatable administration of AAV vectors. In addition, combined with limb perfusion administration, TCL053 iLNPs could transiently deliver CRISPR-Cas9 mRNA and sgRNA to multiple muscle tissues, reducing immunogenicity and increasing the safety of iLNPs. It is great progress for treating Duchenne muscular dystrophy and other diseases that require multiple doses.

NT1-O14B is a tryptamine-containing cationic lipidoid.1 It has been used in combination with other lipids in the formation of lipid nanoparticles (LNPs). Intravenous administration of LNPs containing NT1-O14B and encapsulating antisense nucleotides against tau decreases tau brain levels in mice.

N-[1-(2,3-Dioleyloxy)propyl]-N,N,N-trimethylammonium (DOTMA) is a cationic lipid.It has been used as a component in liposomes that can be used to encapsulate siRNA, microRNAs, and oligonucleotides and for gene transfection in vitro.

Lipid 29 is an ionizable amino lipid (pKa = 6.91) that has been used in combination with other lipids in the formation of lipid nanoparticles (LNPs).Administration of human erythropoietin (EPO) mRNA in lipid 29-containing LNPs increases serum EPO levels in mice.

DOSPA is a cationic lipid. The formulation of DNA with DOSPA is a very promising transfection system.

Vaxfectin is a cationic lipid-based adjuvant that can be used for plasmid DNA- and protein-based vaccines.

Dlin-MeOH is a lipid product for use in drug delivery systems.

Dioctadecylamine (DODA) is a secondary amine that has been shown to self-organize in plate-like structures in aqueous solution. Dioctadecylamine exhibits sufficiently hydrophobic properties of nanoparticles and good dispersibility in nonpolar solvent. Dioctadecylamine does not form a monolayer above pH 3.9.

DOIC is a cationic lipid that can be used for RNA vaccines.

Ionizable lipid A6 (di(dec-3-yn-1-yl) 9-((4-(dimethylamino) butanoyl)oxy) heptadecanedioate) was developed by modifying the backbone structure of Dlin-MC3-DMA through introducing alkynyl and ester groups into the lipid tails. Alkyne lipid A6 demonstrated a significant improvement in transfection efficiency (~8.5, ~2.0, and ~2.5-fold higher than the original MC3, C12-200 and cKK-E12 containing LNPs, respectively).The performance of the A6 coprepared into iLNPs with other amine-containing lipid materials (cKKE12) was evaluated, and the molar ratio of the formulation was changed to 35:16.0:46.5:2.5 (A6/cKKE12: DOPE: Chol: PEG). The results showed that these formulations synergistically facilitated more effective mRNA delivery and improved tolerability following single and repeated dosing. It was confirmed that albumin-associated macrophage phagocytosis and endocytosis is an apolipoprotein-independent cellular internalization pathway of iLNPs in the liver. According to the fusion kinetics, the lipids with highfrequency tail protrusion and high lateral diffusion coefficient can perturb and trigger membrane sprouting, which in turn promotes membrane fusion. The application of iLNPs with those lipids (such as A6) may be an effective method to further enhance the release of mRNA in vivo.

113-O12B is a disulfide bond-containing ionizable cationic lipidoid. 113-O12B LNP, an LN-targeting LNP delivery system, is developed for a mRNA cancer vaccine. The 113-O12B/mRNA shows enhanced expression in APCs compared with ALC-0315/mRNA, indicating the LN-specific targeting ability.

306Oi10 is a branched-chain ionizable lipidoid and may be useful in the generation of lipid nanoparticles (LNPs). 306Oi10 ionizable lipids tail is isodecyl acrylate, affording the lipid tail a carbon branch, which confers significant improvement of the mRNA deliver efficiency. Compared with the straight-tailed 306O10, the 306Oi10 with carbon branches at the lipid tail generates more powerful surface ionization at late endosomal pH of 5.0 to improve the delivery efficiency of mRNA. The studies showed that 306Oi10 iLNPs significantly promoted mRNA expression in liver (more than 10- fold).306Oi10 iLNPs could induce stronger protein expression than two benchmark lipids, C12-200 and DLin-MC3-DMA. The total organ protein expression produced by 306Oi10 iLNPs was threefold higher than MC3 and over 20-fold higher expression than C12-200. The 306Oi10 iLNPs could codeliver three distinct mRNAs (luciferase, mCherry, and erythropoietin), or deliver Cas9 mRNA and single guide RNA (sgRNA) separately. Besides, 306Oi10 iLNPs have the potential of mRNA therapy for hepatocellular carcinoma, because they could target malignant hepatocytes, endothelial cells, and Kupffer cells simultaneously. To enable 306Oi10 iLNPs to deliver mRNA to extrahepatic organs, charged phospholipids were used in place of neutral phospholipids. The substitution of DOPE with DOTAP increased the positive surface charge of iLNPs at pH 7 about fivefold and changed the protein expression ratio of liver/lung from 36:1 to 1:56. Similarly, the substitution of DOPE with PS decreased the positive charge and changed the protein expression ratio of liver/spleen from 8:1 to 1:3. Further, the lung-target of DOTAP was better than that of neutral or anionic lipids, which might reduce immune cells infiltration in the lung.

PL1 is a novel biomimetic phospholipid. PL1 nanoparticle delivery of costimulatory receptor CD137 mRNA improved the immunotherapy with an anti-CD137 Ab to some extent in both tumor models with better results obtained in the B16F10 melanoma model as compared to the A20 lymphoma model.

OF-Deg-Lin is a biodegradable lipid containing an ester group, developed from the nonbiodegradable, linoleic acid derived OF-02; mRNA-LNPs containing OF-Deg-Lin showed high expression in the spleen. The ionizable lipid Of-Deg-Lin was synthesized, which possessed the similar chemical structure with OF-02.Both Of-Deg-Lin and OF-02 had diketopiperazine core and doubly unsaturated tails, and the difference between them was that Of-02 contained nondegradable 1,2-amino-alcohol linkages, whereas Of-Deg-Lin contained degradable ester linkages The change of linker altered iLNPs distribution and mRNA expression in vivo. Although the Of-Deg-Lin iLNPs could accumulate in the liver and spleen, they induced the expression of most functional proteins in B lymphocytes of spleen (over 85% of the total protein), not in the liver. Of-Deg-Lin iLNPs can deliver mRNA and express functional proteins in the spleen specifically, but the mechanism is unclear.

A2-Iso5-2DC18 is a top-performing lipid for mRNA delivery in bone marrow-derived dendritic cells (BMDCs), BMDMs and HeLa cells.

A18-Iso5-2DC18 that could not only deliver mRNA vaccines robustly but also activate the stimulator of interferon genes (STING) pathway. A18-Iso5-2DC18 strongly binds to the stimulator of interferon genes (STING) and induces potent cytolytic T lymphocyte responses, resulting in substantial antitumor immunity (Miao et al. 2019).

306-O12B is a cationic lipidoid.306-O12B LNP is more efficient than MC-3 LNP in inducing loss-of-function mutations in Angptl3 through CRISPR-Cas9-based genome editing. It has been used in the generation of lipid nanoparticles (LNPs). Intravenous administration of LNPs containing 306-O12B and encapsulating an mRNA reporter accumulate specifically in the mouse liver. LNPs containing 306-O12B and encapsulating mRNA encoding the Cas9 nuclease (mCas9) and single-guide RNA targeting Angptl3 (sgAngptl3), the gene encoding angiopoietin-related protein 3, have been used to induce CRISPR-mediated gene knockdown in mice resulting in a reduction of serum Angptl3 protein, LDL, and triglyceride levels. A novel ionizable lipids library was constructed by a combinatory solvent-free Michael addition reaction between disulfide bondincorporated acrylate lipid tails and amine-containing heads. In this library, the tail-branched bioreducible ionizable lipid 306-O12B was screened out. Due to the presence of special ester bonds and branches in lipid tails, the accumulation of iLNPs in the liver was increased, and endosome escape was prompted. These iLNPs were used to deliver CRISPR-Cas9 mRNA and sgRNA targeting to angiopoietin-like 3 (Angptl3). Compared with FDA-approved MC3, 306-O12B induced more specific and efficient Angptl3 gene knockout in the liver, resulting in significant decrease in the levels of serum Angptl3 protein, low-density lipoprotein cholesterol (LDL-C), and triglyceride. According to the molecular shape hypothesis outlined several decades ago, the increase of branches can create ionizable lipids with more cone-shaped structure to enhance the destructiveness of the membrane structure of the endosome and increase mRNA release. However, it is unknown whether the structural stability of iLNPs will be sacrificed with the increase of branches. The optimal branches and chain length need to be further explored.

OF-C4-Deg-Lin is a novel ionizable lipid for RNA delivery. OF-C4-Deg-Lin LNPs entrapping mRNA coding for luciferase induce the majority of protein expression in the spleen, with minimal translation in the liver, and negligible translation in other organs. OF-C4-Deg-Lin LNPs entrapping mRNA coding for luciferase induce the majority of protein expression in the spleen, with minimal translation in the liver, and negligible translation in other organs. To improve the mRNA delivery to extrahepatic tissues, a series of degradable diketopiperazine-based ionizable lipids were synthesized. Through evaluating the mRNA functional activity delivered by iLNPs, it was found that the ionizable lipids with doubly unsaturated lipid tails and linkers containing a length of four carbon aliphatic chain (Of-C4-Deg-Lin) could deliver the mRNA more efficiently. Moreover, compared with cKK-E12 and Invivofectamine, Of-C4-Deg-Lin could specifically induce more than 85% of firefly luciferase expression in spleen,minimal expression in the liver, and insignificant expression in other tissues.

C24-Ceramide is a sphingolipid that can be used for the lipid membranes composed. C24-Ceramide induces time-dependent changes in membrane properties. C24-Ceramide induces membrane reorganization.

TriGalNAc CBz is a GalNAc derivative and tri-GalNAc is an asialoglycoprotein receptor (ASGPR) ligand. TriGalNAc CBz can be used for mRNA drug delivery as well as lysosomal targeted chimerism (LYTAC) studies.

L202 is a novel ionizable lipid for RNA delivery.

4A3-SC8 is a novel Ionizable amino lipid for RNA delivery.The CRISPR-Cas9 gene editing system has been a hotspot in the field of gene therapy, especially the gene correction induced by homology-directed repair (HDR). However, its application has various obstacles, such as large molecular weight, poor stability, off-target risk, and the complexity of codeliver multiple genes. Farbiak et al. established a novel ionizable lipid library consisting of four distinct amine cores (3A3, 3A5, 4A1, 4A3) and nine peripheries with different alkyl chain lengths (SC5-SC14), and screened out a class of iLNPs with ability of encapsulating Cas9 mRNA, sgRNA and donor DNA simultaneously. The delivery efficiency (quantified by luciferase mRNA expression) and iLNPs toxicity were evaluated with three different cell lines (HEK293T, HeLa, and IGROV-1), indicating the formulation containing 4A3-SC8 was the best. 4A3-SC8 iLNPs successfully induced HDR in HEK293 cells by one-pot delivery of Cas9 mRNA, sgRNA, and the correct ssDNA template. Confocal microscopy imaging showed that a portion of blue fluorescence in cells was corrected to green fluorescence. Furthermore, the nucleic acid ratios of Cas9: sgRNA: donor DNA loading in iLNPs at a ratio of 2:1:3 could maximize the HDR efficiency with the editing efficiency up to 23%, which breaks through the current bottleneck of HDR efficiency of only 1–5%. This progress is undoubtedly an important advance in the gene therapy field to cure diseases caused by genetic mutations.

ATX-001 is a novel ionizable cationic lipid compound for RNA delivery.

A12-Iso5-2DC18 is a novel amine containing lipid can be used for mRNA delivery, activate the stimulator of interferon genes (STING) pathway, and exhibit anti-tumor immunity.

ATX-081 is a novel ionizable lipid for rna delivery.

ATX-083 is a novel ionizable lipid for rna delivery.

ATX-084 is an ionizable cationic lipids for RNA or Gene delivery.

ATX-087 is a novel ionizable lipid for rna delivery.

304O13 is a novel Biodegradable lipidoid for RNA delivery.

CSL3 is a novel cationic switchable lipid, pH-triggered molecular switch for siRNA delivery.In vivo factor VII silencing efficiency of the CSL3-based formulations was compared to that of the CSL4-based formulation (Fig. 5E). CSL3-based LNP were found to demonstrate a dose–response knockdown, resulting in significant silencing efficacy (∼50% silencing) at 1 mg kg−1.These results confirm the crucial role of the pH-sensitive conformational change of CSL3 in the in vivo transfection efficacy, in agreement with the in vitro results. The in vivo silencing efficacy of the CSL3 LNP may be further improved by lowering the molar percentage of DMG-PEG2000 in the formulation11,33 or by using combinatorial approaches to enhance the potency of the CSL3 lipid structure as well as the blood stability of the LNP (currently under investigation).

Fomivirsen (ISIS-2922 free base) is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen is an antiviral agent that is used cytomegalovirus retinitis (CMV) research, incluiding in AIDs. Fomivirsen binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation.

DSPE-SPDP is a phospholipid molecule. DSPE-SPDP can orient itself to form lipid bilayer in water. DSPE-SPDP can be used for the research of various biochemical.

DSPE-MAL is a thiol reactive a phospholipid compound. DSPE-MAL has two saturated fatty acids and can self-assemble in water to form lipid bilayer. DSPE-MAL can be used to prepare liposomes as drug nanocarrier.

DSPE-N3 is a lipid. DSPE-N3 can be used for the research of various biochemical.

Tri-GalNAc-NHS ester is a LYsosome TArgeting Chimera (LYTAC) and a ligand of asialoglycoprotein receptor (ASGPR). ASGPR is a lysosomal targeting receptor specifically expressed on liver cells, for the degradation of extracellular proteins including membrane proteins. Tri-GalNAc-NHS ester can be used as a protein degrader and it can be used for the research of LYTAC.

306-O12B-3 is an ionizable cationic lipidoid. It has been used in the generation of lipid nanoparticles (LNPs) for the delivery of antisense oligonucleotides (ASOs). LNPs containing 306-O12B-3 localize to the liver after intravenous administration in mice. LNPs containing 306-O12B-3 in combination with other lipids encapsulating ASOs targeting the gene encoding proprotein convertase subtilisin kexin type 9 (PCSK9) decrease hepatic PCSK9 expression in mice. Intravenous administration of LNPs containing 306-O12B-3 and the cationic lipidoid NT1-O14B encapsulating ASOs against tau decreases tau expression and levels in mouse brain.

AA3-DLin is an ionizable cationic amino lipid (pKa = 5.8) that has been used in combination with other lipids in the formation of lipid nanoparticles (LNPs) for the delivery of mRNA.LNPs containing AA3-DLin and encapsulating mRNA for the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) spike glycoprotein induce immunogenicity in mice.

PPZ-A10 is an ionizable cationic lipid.It has been used in the generation of lipid nanoparticles (LNPs) for the delivery of siRNA and mRNA in vitro and in vivo. Intraperitoneal administration of LNPs containing PPZ-A10 and encapsulating an mRNA reporter preferentially accumulates in hepatic Kupffer cells and splenic macrophages in mice.

93-O17O is a chalcogen-containing ionizable cationic lipidoid. It has been used in the generation of lipid nanoparticles (LNPs). LNPs containing 93-O17O localize to the spleen after intravenous injection into mice.LNPs containing 93-O17O have been used for the delivery of Cre recombinase and ribonucleoproteins for genome editing in mice and for the intratumoral delivery of cGAMP to enhance cross-presentation of tumor antigens.

LIPID-10a-26 is an analogue of ALC-0315 with the head adjusted to imidazole. It is a novel cationic ionizable Lipid for RNA delivery.

BAMP-TK-12 is ROS‐degradable lipid used for gene/RNA delivery.

113-O16B is a disulfide bond-containing ionizable cationic lipidoid. It has been used in the generation of lipid nanoparticles (LNPs) for the delivery of mRNA.

LIPID 14 is a novel ionizable lipid used for mRNA delivery.In 2021, Elia et al. used lipid 2 LNPs and lipid 14 LNPs to deliver mRNA encoding SARSCoV-2 human Fc-conjugated receptor binding domain (RBDhFc mRNA). While both lipid 274 LNP RBD-hFc mRNA and lipid 14 LNP RBD-hFc mRNA induced equal cellular and humoral responses in mice at an mRNA dose of 5 μg, only lipid 14 LNP RBD-hFc mRNA exhibited strong immunogenicity following intradermal administration. Both intradermal administration and intramuscular administration of lipid 14 LNPs could activate antigen presenting cells (APCs), thus inducing cellular responses.

IC8 is an ionizable cationic lipid. It has been used in combination with other lipids for the formation of lipid nanoparticles (LNPs). Immunization with severe acute respiratory coronavirus 2 (SARS-CoV-2) spike glycoprotein mRNA in IC8- and manganese-containing LNPs induces IgG responses to SARS-CoV-2 Delta and Omicron variants in mice.1 Administration of mRNA encoding B7-H3 X CD3 bispecific T cell engaging (BiTE) antibodies in IC8-containing LNPs reduces tumor growth in MV4-11 and A375 mouse xenograft models.

SSPalmM is an ionizable cationic disulfide-cleavable (SS-cleavable) proton-activated lipid-like material (SSPalm).

80-O16B is a disulfide bond-containing ionizable cationic lipidoid. It has been used in the generation of lipid nanoparticles (LNPs) for the delivery of CRISPR complementary single-guide RNA (sgRNA) and Cas9 for genome editing in mice. LNPs containing 80-O16B conjugated to phenylboronic acid (PBA) and encapsulating an mRNA reporter increase luciferase reporter expression in HeLa cancer cells.2 LNPs containing 80-O16B conjugated to PBA and encapsulating p53 mRNA decrease the viability of DU145 prostate and SiHa and HeLa cervical cancer cells.

A066 is a lipid for RNA and vaccine delivery.A-066 is an analog of DODMA that contains a pyrrole head group. A-066 LNPs encapsulating TetR siRNA could induce significant antitumor efficacy in orthotopic hepatocellular carcinoma models.

DMAP-BLP is a lipid for RNA and vaccine delivery.DMAP-BLP exhibits optimized bilayer destabilizing and pKa properties leading to highly potent gene silencing in hepatocytes following IV administration that is similar to “gold standard” lipids such as DLinMC3-DMA.

Dimethyldioctadecylammonium bromide (DDAB) is a cationic surfactant that is used as an antimicrobial agent.

DiC14-amidine (amidine) is a nonphysiological, cationic lipid that forms stable liposomes under physiological pH and temperature.

DMRIE is a cationic lipid, suitable for transfecting DNA and RNA into eukaryotic cells, and is particularly effective for transfecting suspension cells (e.g., Jurkat) and other lymphoid-derived cell lines.

DlenDMA is a lipid for RNA and vaccine delivery. DLenDMA showed better siRNA transfection efficiency than DODMA.

GL 67 (N4-Spermine cholesteryl carbamate) is a cationic lipid. GL-67 can be used for nucleic acid agents and vaccines delivery, and gene transfection[1]. Genzyme Lipid (GL67), The cationic lipid N4 -cholesteryl-spermine is one of the most effective non-viral gene carriers comprising spermine as a headgroup that bond in a T-shape configuration to a cholesterol anchor.

BGTC is a non-amino acid cationic lipid. BGTC can be used for delivery of nucleic acids.

CTAP is a selective μ opioid receptor antagonist that displays selectivity over δ opioid and somatostatin receptors. CTAP is brain penetrant and active in vivo.

TNT-b10 is a novel Lipid-like compound suitable for delivery of siRNA and mRNA both in vitro and in vivo TNT-b10 LLNs was more than 10-fold more potent than TNT-a10 LLNs formulated under the same condition.

mono-Pal-MTO is a palm oil-based lipid produced by combining the anticancer drug mitoxantrone (MTO) with palmitoleic acid. When nanoparticles of mono-Pal-MTO and di-Pal-MTO are combined in a molar ratio of 1:1, they show effective siRNA cell delivery and enhance anticancer activity.

di-Pal-MTO is a palm oil-based lipid produced by combining the anticancer drug mitoxantrone (MTO) with palmitoleic acid. When nanoparticles of mono-Pal-MTO and di-Pal-MTO are combined in a molar ratio of 1:1, they show effective siRNA cell delivery and enhance anticancer activity.

ALC-0315 analgous-1 is an ethanolamine ionizable lipid with both ester bonds located adjacent to C8 relative to the amine head. The introduction of ester linkages can improve the clearance of the lipid in the liver. This compound is analgous to ALC-0315.

C13-112-tri-tail is an ionizable lipid molecule containing a polar amino alcohol head group, three hydrophobic carbon-13 tails, and a PEG2 linker. The lipoid can be formulated into a lipid nanoparticle (LNP) to deliver anionic substrates in vitro and in vivo. This includes siRNA to induce gene silencing in a sequence-specific manner, CAS9 mRNA, and cytotoxic proteins. Reagent grade, for research purpose. Please contact us for GMP-grade inquiries.

C13-113-tri tail is an ionizable lipid molecule containing a polar amino alcohol head group, three hydrophobic carbon-13 tails, and a tertiary amine linker. The lipoid can be formulated into a lipid nanoparticle (LNP) to deliver anionic substrates in vitro and in vivo. This includes siRNA to induce gene silencing in a sequence-specific manner, CAS9 mRNA, and cytotoxic proteins. Reagent grade, for research purpose. Please contact us for GMP-grade inquiries.

C13-112-tetra-tail is an ionizable lipid molecule containing a polar amino alcohol head group, four hydrophobic carbon-13 tails, and a PEG2 linker. The lipoid can be formulated into a lipid nanoparticle (LNP) to deliver anionic substrates in vitro and in vivo.

C13-113-tetra tail is an ionizable lipid molecule containing a polar amino alcohol head group, four hydrophobic carbon-13 tails, and a tertiary amine linker.

TAP (14:0) A cationic lipids that can be used for drug delivery, gene transfection and vaccine delivery. TAP has been proven to be efficient for in vitro and in vivo transfection applications, which makes it one of the most widely used cationic lipids for gene transfection applications. Reagent grade, for research use only.

16:0 TAP is a cationic derivative of trimethylammonium linked with two 16-carbon fatty acid tails. 16:0 TAP is a cationic liposome-forming compound that may be used for transfection of DNA, RNA, and other negatively charged molecules into eukaryotic cells. Reagent grade, for research use only.

18:0 TAP is a cationic derivative of trimethylammonium linked with two 18-carbon fatty acid tails. 18:0 TAP is a cationic liposome-forming compound that may be used for transfection of DNA, RNA, and other negatively charged molecules into eukaryotic cells. Reagent grade, for research use only.

18:1 TAP is a cationic liposome-forming compound that may be used for transfection of DNA, RNA, and other negatively charged molecules into eukaryotic cells. Reagent grade, for research use only.

DC-6-14 is a cationic lipid that can be used for drug delivery, gene transfection and vaccine delivery. DC-6-14 may be used for research into in vitro and in vivo nucleic acid and protein delivery. Reagent grade, for research use only.

12:0 EPC (Cl Salt) is a cationic derivatives of phospholipids consisting entirely of biological metabolites linked with two 12-carbon fatty acid tails. The lipid has low toxicity and is biodegradable. Reagent grade, for research use only.

14:0 EPC (Cl Salt) is a cationic derivatives of phospholipids consisting entirely of biological metabolites linked with two 14-carbon fatty acid tails. The lipid has low toxicity and is biodegradable.

16:0 EPC (Cl Salt) is a cationic derivatives of phospholipids consisting entirely of biological metabolites linked with two 16-carbon fatty acid tails. The lipid has low toxicity and is biodegradable. Reagent grade, for research use only.

18:0 EPC (Cl Salt) is a cationic derivatives of phospholipids consisting entirely of biological metabolites linked with two 18-carbon fatty acid tails. The lipid has low toxicity and is biodegradable. Reagent grade, for research use only.

14:1 EPC (Tf Salt) is a cationic derivatives of phospholipids consisting entirely of biological metabolites linked with two 14-carbon fatty acid tails with single alkene groups in each tail. The lipid has low toxicity and is biodegradable. Reagent grade, for research use only.

18:1 EPC (Cl Salt) is a cationic derivatives of phospholipids consisting entirely of biological metabolites linked with two 18-carbon fatty acid tails with single alkene groups in each tail. The lipid has low toxicity and is biodegradable. Reagent grade, for research use only.

16:0-18:1 EPC (Cl Salt) is a cationic derivatives of phospholipids consisting entirely of biological metabolites linked with one 16-carbon fatty acid tail and one 18-carbon fatty acid tail with a single alkene group. The lipid has low toxicity and is biodegradable. Reagent grade, for research use only.

16:0 DAP, 1,2-dipalmitoyl-3-dimethylammonium-propane, is a cationic lipid that can be used to formulate lipid nanoparticles (LNPs). 18:0 DAP also serves as a pH-sensitive transfection reagent. Reagent grade, for research use only.

DORI, N-(2-hydroxyethyl)-N,N-dimethyl-2,3-bis(oleoyloxy)propan-1-aminium bromide, is an ionizable cationic lipid with lower cytotoxicity and high transfection efficiency. Reagent grade, for research use only.

DOBAQ, N-(4-carboxybenzyl)-N,N-dimethyl-2,3-bis(oleoyloxy)propan-1-aminium, is a cationic lipids with a quaternary amine and unsaturated hydrocarbon chains. DOBAQ also serves as a pH-sensitive transfection reagent. Reagent grade, for research use only.

Arcturus lipid 2 analog (Lipid 2,2 (9,9) 4C CH3) is an analog of Arcturus lipid 2((Lipid 2,2 (8,8) 4C CH3)) with chain adjusted to C9 instead of C8.

1,2-Dioleoyl-3(R)-trimethylammoniumpropane (R-DOTAP) is a cationic lipid and the more immunologically active isomer of DOTAP.Lipoplexes containing R-DOTAP and encapsulating siRNA targeting the gene encoding aromatase, CYP19A1, decrease aromatase activity in MCF-7 breast cancer cells.1 Vaccination with a peptide epitope from human papillomavirus (HPV) 16 protein E7 in R-DOTAP-containing liposomes induces IFN-γ production by CD8+ T cells and tumor-infiltrating lymphocytes (TILs) and decreases tumor size in a murine cervical cancer model.2 Subcutaneous immunization with recombinant influenza B hemagglutinin using R-DOTAP as an adjuvant increases IL-2 and IFN-γ production in CD4+ T cells isolated from mouse draining lymph nodes and spleen.

4A3-Cit is an ionizable lipid used for the generation of lipid nanoparticles (LNPs). To investigate the role of unsaturated lipid tails in iLNPs, the nucleophilic amines were added to ester-based linkers, followed by Michael’s addition to the thiols to construct a library of 91 amino ionizable lipids. Such ionizable lipids were composed of an ionizable tertiary amine core, an ester-based degradable linker, and an alkylthiol tail periphery. Through in vitro and in vivo screening, the iLNPs with 4A3 core and citronellolbased (Cit) periphery can significantly increase endosome escape and delivery efficiency of mRNA, leading to 18-fold increase in protein expression compared with iLNPs without Cit periphery. Furthermore, the delivery efficiency of mRNA may be associated with the location/configuration of the unsaturated bond(s) in lipids. Although lipids with Cit periphery showed excellent membrane fusion ability to facilitate endosome escape, the fusion mechanism needs to be further clarified.

G0-C14 is a cationic lipid-like compound alkyl-modified polyamidoamine (PAMAM) dendrimer. G0-C14 involves in the preparation of a series of macrophage-targeted nanoparticles (NPs). NPs can be used for drug and vaccine delivery[1][2].

YK-009 is a novel ionizable lipid for mRNA delivery. Comparisons of YK009-LNP-mRNA and commercial MC3-LNP-mRNA showed that YK009-LNP-mRNA vaccines had good biodistribution patterns, favorable tissue clearance, and high delivery efficiency. Furthermore, our study proved that YK009-LNP-Omicron mRNA could trigger a robust immune response and immune protection against the SARS-CoV-2 Omicron variant.

Lipidoid S14 is a novel lipidoid for siRNA delivery.Lipidoid-polymer hybrid nanoparticle (FS14-NP) can efficiently deliver siRNA against IL-1β (siIL-1β) to macrophages and effectively suppress the pathogenesis of experimental arthritis induced by collagen antibody (CAIA mice). FS14-NP/siIL-1β achieved approximately 70% and 90% gene-silencing efficiency in the RAW 264.7 cell line and intraperitoneal macrophages, respectively. Intravenous administration of FS14-NP/siRNA led to rapid accumulation of siRNA in macrophages within the arthritic joints. Furthermore, FS14-NP/siIL-1β treatment lowered the expression of pro-inflammatory cytokines in arthritic joints and dramatically attenuated ankle swelling, bone erosion, and cartilage destruction.

Lipid 8 iLNPs were used to deliver CRISPR-Cas9 mRNA and sgRNA which targeted to the PLK1 gene. The safety and excellent intracerebral diffusion performance of lipid 8 iLNPs ensured that the survival of murine glioblastoma multiforme (GBM) mice was extended. The median survival was extended by approximately 50% and the overall survival was increased by 30%. The treatment of metastatic adenocarcinoma was executed by the EGFRtargeted lipid 8 iLNPs. These iLNPs possessed the ability of tumor targeting, which could increase the accumulation of CRISPR-Cas9 mRNA and sgRNA within the tumor cells. After a single intraperitoneal administration,
80% PLK1 gene was edited and the overall survival of mice with high-grade ovarian cancer malignant ascites was enhanced by
80% . These results demonstrate the clinical potential of CRISPR-Cas9 gene editing system can be delivered by iLNPs for treating tumors, and provide new ideas for tumor gene therapy.

AL-A12 is an ionizable cationic amino lipid that has been used in the formation of lipid nanoparticles (LNPs).1 LNPs containing AL-A12 and encapsulating minicircle DNA that encodes for GFP have been used to induce GFP expression in Huh7 cells.

D-Lin-MC4-DMA(MC4) is a cationic lipid that has been synthesized for Lipid nanoparticles (LNPs) to deliver the siRNA.

D-Lin-MC2-DMA(MC2) is a cationic lipid that has been synthesized for Lipid nanoparticles (LNPs) to deliver the siRNA.

DSG-PEG2000 is used for liposome preparation. DSG-PEG, MW 2,000 has become known for lipid nanoparticle (LNP) preparation for siRNA (small interfering RNA) delivery research. .

RM133-3 is an ionizable lipid for potent functional mRNA delivery in vivo. The LPN formulation RM133-3-21, is found to be roughly 4.5 times more potent than DLin-MC3-DMA.

1,2-Distearoyl-sn-glycero-3-phosphorylglycerol is used as a component of a loposomal delivery system that coordinates the release of irinotecan and floxuridine in vivo. It is also used to encapsulate anthracyclines and deliver them to tumors.DSPG has a high transition temperature and has therefore found much use in liposomal drug delivery systems.

Lipid 10 is a novel ionizable cationic lipid be used for delivery of therapeutic RNA to the Bone Marrow in Multiple Myeloma Using CD38-Targeted with Lipid 10-LNP.

BIOTIN-11-DCTP is a fluorescent dye for DNA labeling.

306-N16B is a lipidnanoparticle, and allows systemic codelivery of Cas9 mRNA and sgRNA. 306-N16B can transport mRNA to the pulmonaryendothelial cell. 306-N16B can be used for research of genome editing-based therapies. Based on the same lipid libraries with 306-O12B, the researchers also found that N-series ionizable lipids were able to selectively deliver mRNA to the lungs of mice. Compared with the liver-targeted O-series ionizable lipids which contained ester bond in lipid tail found in previous work, such as 306-O12B, the N-series ionizable lipids with the lipid tail containing amide bond prefer to deliver mRNA to the lung. As a N-series ionizable lipid, the chemical structure of the 306-N16B is shown in Figure 4a,b. The difference of organ targeting may be due to their adsorption of different protein coronas during blood circulation caused by their different structures mentioned earlier.It has shown that the second major protein of the protein corona adsorbed by liver-targeting 306-O12B iLNPs was apolipoprotein E (ApoE), while the three dominant proteins in the protein corona adsorbed by lung-targeting 306-N16B iLNPs were serum albumin, fibrinogen beta chain, and fibrinogen gamma chain. However, the 306-N16B iLNPs showed less organ selectivity when systematically codelivered Cas9 mRNA and sgRNA in vivo, which could simultaneously activate tdTomato expression in the liver and lung of Ai14 mice, whereas single mRNA delivery could almost exclusively deliver mRNA to the lungs. This surprising phenomenon requires further investigation. Both the change of iLNPs charge and the change of lipids functional group can influence the distribution of iLNPs in vivo due to the altering of protein corona composition. Therefore, it is possible to control the organ targeting of iLNPs by controlling the composition of the outer protein corona of iLNPs.

AA-T3A-C12 is an anisamide ligand-tethered lipidoid (AA-lipidoid) with high potency and selectivity to deliver RNA payloads to activated fibroblasts. HSP47 siRNA (siHSP47)-loaded AA-T3A-C12 LNP achieves ~65% knockdown and dramatically reduces liver fibrosis, which significantly outperforms the benchmark DLin-MC3-DMA (MC3) LNP.

ALC-0315 analogue-2 is an analogue of ALC-0315. ALC-0315 is an ionisable aminolipid that is responsible for mRNA compaction and aids mRNA cellular delivery and its cytoplasmic release through suspected endosomal destabilization. ALC-0315 can be used to form lipid nanoparticle (LNP) delivery vehicles. Lipid-Nanoparticles have been used in the research of mRNA COVID-19 vaccine.

Lipid 6 is an ionizable amino lipid used for the generation of Lipid nanoparticles .

A2-Iso5-4DC19 is a lipidoid compound. A2-Iso5-4DC19 is an effective carrier for the delivery of an agent such as a polynucleotide to a cell.

Lipid 15 is an ionizable amino lipid used for the generation of Lipid nanoparticles .

LNP Lipid-5 (Compound Lipid 2) is an ionizable lipid (amino lipid). LNP Lipid-5 can be used to prepare lipid nanoparticles .