| DC71480 |
Canocapavir |
Canocapavir (ZM-H1505R) has orally antiviral activity. Canocapavir is a HBV capsid inhibitor that can be used in the research of Chronic hepatitis B. . |
|
| DC71481 |
Bepirovirsen
Featured
|
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC). |
|
| DC71482 |
RPR103611 |
RPR103611, the betulinic acid derivative, is a potent HIV-1 entry inhibitor with IC50s of 80, 0.27, and 0.17 for CCR5-tropic virus YU2, CXCR4-tropic virus NL4-3 and dual tropic virus 89.6, respectively. |
|
| DC71483 |
WAY-383487 |
WAY-383487 is one of the Tat peptide derivatives and inhibits HIV-1 long terminal repeat-activated transcription. |
|
| DC71484 |
Primaquine |
Primaquine is a potent antimalaria agent and a potent gametocytocide in falciparum malaria. Primaquine prevents relapse in vivax and ovale malaria. |
|
| DC71485 |
Ep vinyl quinidine |
Ep vinyl quinidine (3-Epiquinine) is an epi-vinyl stereoisomer of Quinidine. Quinidine is an antiarrhythmic agent. Quinidine is a potent, orally active, selective cytochrome P450db inhibitor. Quinidine is also a K+ channel blocker with an IC50 of 19.9 μM. Quinidine can be used for malaria research. |
|
| DC71486 |
Piperaquine tetraphosphate |
Piperaquine tetraphosphate is a potent antimalaria agent. Piperaquine tetraphosphate shows inhibition for chloroquine-sensitive and the chloroquine-resistant isolates. Piperaquine tetraphosphate in combination with dihydroartemisinin has the potential for the research of chloroquine-resistant malaria. |
|
| DC71487 |
PT4 |
PT4 is a therapeutic agent against Cutaneous leishmaniasis (CL). PT4 is effective against both species of Leishmania, with IC50s of 125.18 and 233.18 μM for L. amazonensis and L. braziliensis, respectively. PT4 decreases of mitochondrial membrane potential and increases production of reactive oxygen species, which leads to parasite death. PT4 has a potent in vivo anti-inflammatory activity. |
|
| DC71642 |
Gemifloxacin |
Gemifloxacin, a fluoroquinolone, is a potent and orally active antipneumococcal agent. Gemifloxacin shows bactericidal activity against highly quinolone-resistant pneumococci.Gemifloxacin can be used for the research of respiratory infections, such as community-acquired pneumonia (CAP) and acute exacerbation of chronic bronchitis (AECB). |
|
| DC71643 |
Ceftaroline fosamil (hydrate)(acetate) |
Ceftaroline fosamil hydrate acetate is a potent cephalosporin antibiotic. Ceftaroline fosamil hydrate acetate shows broad-spectrum activity against Gram-positive pathogens, including methicillin-resistant Staphylococcus aureus (MRSA) and multidrug-resistant Streptococcus pneumoniae, and common Gram-negative organisms. Ceftaroline fosamil hydrate acetate has anti-infective activity, and can be used for the research of complicated skin and skin structure infections (cSSSIs) and community-acquired bacterial pneumonia (CABP). |
|
| DC71644 |
Erythromycin stearate |
Erythromycin stearate is a macrolide antibiotic produced by actinomycete Streptomyces erythreus with a broad spectrum of antimicrobial activity. Erythromycin stearate binds to bacterial 50S ribosomal subunits and inhibits RNA-dependent protein synthesis by blockage of transpeptidation and/or translocation reactions, without affecting synthesis of nucleic acid[1][2]. Erythromycin stearate also exhibits antitumor and neuroprotective effect in different fields of research[3][4]. |
|
| DC71645 |
Zanamivir (hydrate)(5:1) |
Zanamivir hydrate (5:1) is the hydrate of Zanamivir. Zanamivir is an influenza viral neuraminidase inhibitor with IC50 values of 0.95 nM and 2.7 nM for influenza A and B, respectively. |
|
| DC71646 |
Ticarcillin |
Ticarcillin is a semisynthetic, extended-spectrum, carboxypenicillin antibacterial agent, and is active against gram-positive cocci, including streptococci and staphylococci. Ticarcillin is also effective against most gram-negative organisms, including Pseudomonas aeruginosa. Ticarcillin can be used in lower respiratory tract infections, skin and skin structure infections, urinary tract infections, and intraabdominal infections research. |
|
| DC71648 |
Riamilovir |
Riamilovir (Triazavirin) is a broad-spectrum antiviral drug candidate, which can be used for potential application against the Coronavirus 2019-nCoV. |
|
| DC71649 |
LL-37(human) |
LL-37, human is a 37-residue, amphipathic, cathelicidin-derived peptide, which exhibits a broad spectrum of antimicrobial activity. |
|
| DC71650 |
BVDV IN-1
Featured
|
BVDV IN-1 is a non-nucleoside inhibitor of bovine viral diarrhea virus (BVDV), with an EC50 of 1.8 μM. |
|
| DC71651 |
Gentamicin |
Gentamicin, an aminoglycoside class of bactericidal antibiotic, is effective against gram-negative bacterial infections. |
|
| DC71652 |
Alisporivir |
Alisporivir (Debio-025) is a cyclophilin inhibitor molecule with potent anti-hepatitis C virus (HCV) activity. |
|
| DC71675 |
Raltegravir sodium |
Raltegravir (MK 0518) sodium is a potent and orally active integrase (IN) inhibitor, used to treat HIV infection. |
|
| DC71682 |
HOE961 |
HOE961, the diacetate ester prodrug of S2242, is active against respiratory cowpox virus infections, is orally active in infection models. Anti-orthopoxvirus activity. |
|
| DC71703 |
3-Chlorogentisyl alcohol |
3-Chlorogentisyl alcohol is a potent E. coli β-glucuronidase inhibitor with an IC50 value of 0.74 µM, an Ki value of 0.58 µM. 3-Chlorogentisyl alcohol shows antiproliferative activity. 3-Chlorogentisyl alcohol has the potential for the research of anti-cancer and anti-inflammatory therapies. |
|
| DC71704 |
Alpibectir |
Alpibectir is an antibacterial agent. |
|
| DC71705 |
ANT3310 sodium |
ANT3310 sodium is a broad-spectrum covalent Serine β-Lactamase inhibitor, with IC50 values ranging from 1 nM to 175 nM (a panel of Serine β-Lactamase). ANT3310 sodium potentiates activity of β-lactam antibiotics against Carbapenem-Resistant Enterobacterales (CRE) and Acinetobacter baumannii (CRAB). ANT3310 sodium can be used in the research of bacterial infection. |
|
| DC71706 |
BPH-1086
Featured
|
BPH-1086 (compound 10) is an IspH inhibitor, IspH domain fused with ribosomal protein S1 (RPS1) can bind to mRNA or form part of the bacterial ribosome. |
|
| DC71708 |
P163-0892 |
P163-0892 is a potent and selective antifungal agent against Cryptococcus species. P163-0892 is predicted to show medium BBB penetration. |
|
| DC71709 |
Dasabuvir sodium |
Dasabuvir (ABT-333) sodium is a nonnucleoside hepatitis C virus (HCV) polymerase inhibitor. Dasabuvir sodium inhibits RNA-dependent RNA polymerase encoded by the HCV NS5B gene. Dasabuvir sodium inhibits genotype 1a (strain H77) and 1b (strain Con1) replicons, with EC50 values of 7.7 and 1.8 nM, respectively. |
|
| DC71710 |
Emitasvir diphosphate |
Emitasvir (DAG181) diphosphate is an orally active hepatitis C virus (HCV) nonstructural protein 5A (NS5A) inhibitor and can be used for research of chronic hepatitis C virus infection. |
|
| DC71711 |
GSK5852 |
GSK5852 (GSK2485852) is an HCV NS5B polymerase inhibitor, with an IC50 value of 50 nM. GSK5852 displays antiviral activity and inhibits HCV with EC50s of 3.0 nM (genotype 1a, GT1a) and 1.7 nM (GT1b), respectively. |
|
| DC71712 |
EP39 |
EP39 is a potent HIV-1 maturation inhibitor. EP39 interacts with the SP1 domain of Gag. EP39 decreases the dynamics of CA-SP1 junction, by binding to the QVT motif of the SP1 domain, and perturbs the natural coil-helix equilibrium on both sides of the SP1 domain by stabilizing the transient alpha helical structure. EP39 acts by arresting maturation of HIV-1 thereby blocking its infectivity. |
|
| DC71713 |
ZLM-66 |
ZLM-66 is an orally active non-nucleoside reverse transcriptase inhibitors (NNRTIs) and biphenyl-containing doravirine analog. ZLM-66 shows an EC50 value of 13 nM against wild-type HIV-1. ZLM-66 can be used for the research of HIV. |
|
