DC71275 |
Sulconazole |
Sulconazole is a potent antifungal agent in the imidazole class. Sulconazole blocks the NF-κB/IL-8 signaling pathway and CSC (Cancer stem cells) formation. Sulconazole inhibits tumor growth, and can be used for breast cancer research. |
|
DC71276 |
WRNA10 |
WRNA10 is a potent HIV-1 TAR RNA binder with an IC50 of 10 µM and an CC50 of 40 µM. |
|
DC71277 |
CI-39 |
CI-39 is an antiviral natural product. CI-39 is an NNRTI (non-nucleoside reverse transcriptase inhibit) antiviral agent with an EC50 of 3.40 µM and an CC50 of >30 µM for wild type HIV-1. CI-39 inhibits HIV-1 RT DNA polymerase and ribonuclease H activitiessup. |
|
DC71278 |
A3N19 |
A3N19 is a potent HIV-1 non-nucleoside reverse transcriptase inhibitor, with an EC50 of 3.28 nM against HIV-1 IIIB. |
|
DC71279 |
MMV687807 |
MMV687807 is an anthelmintic agent which has a good activity against Toxoplasma gondii (T. gondii) with an IC50 value of 0.15 μM and a CC50 value of 1.69 μM. |
|
DC71280 |
Coronastat |
Coronastat is a potent inhibitor of the SARS-CoV-2 3CL protease. The SARS-CoV-2 3CL protease is a critical drug target for small molecule COVID-19, given its likely druggability and essentiality in the viral maturation and replication cycle. |
|
DC71281 |
FWM-1 |
FWM-1 is a potent SARS-COV-2 NSP13 helicase enzyme inhibitor with binding free energy equals -328.6 kcal/mol. FWM-1 effectively disrupts the binding of ATP to the SARS-COV2 helicase enzyme. |
|
DC71282 |
Fmoc-leucine-15N |
Fmoc-leucine-15N is a 15N-labeled and 13C-labled EIDD-1931. EIDD-1931 (Beta-d-N4-hydroxycytidine; NHC) is a novel nucleoside analog and behaves as a potent anti-virus agent. EIDD-1931 effectively inhibits the replication activity of venezuelan equine ence |
|
DC71283 |
FWM-4 |
FWM-4 is a potent SARS-COV-2 NSP13 helicase enzyme inhibitor. |
|
DC71284 |
FWM-5 |
FWM-5 is a potent NSP13 helicase inhibitor. SARS-COV-2 NSP13 helicase enzyme plays crucial role in the virus life cycle. FWM-5 has the potential for the research of infection diseases. |
|
DC71462 |
CRS3123 dihydrochloride |
CRS3123 (REP-3123) dihydrochloride, a fully synthetic antibacterial agent, potently inhibits methionyl-tRNA synthetase (MetRS) of Clostridioides difficile, inhibiting Clostridioides difficile toxin production and spore formation. CRS3123 dihydrochloride is an oral agent for the research of Clostridioides difficile infection (CDI). |
|
DC71463 |
WX-081
Featured
|
WX-081, an anti-tuberculosis agent, displays excellent anti-mycobacterial activity against M. tuberculosis H37Rv and low cytotoxicity. |
|
DC71464 |
PXYC12 |
PXYC12 is a ribosomal protein S1 (RpsA) antagonist with Kds of 2.67 and 4.67 μM for RpsA-CTD and RpsA-CTD Δ438A, respectively. RpsA plays an important role in the trans-translation process of Mycobacterium Tuberculosis (Mtb). |
|
DC71465 |
VP-4556 |
VP-4556 is a potent anti-methicillin-resistant Staphylococcus aureus (MRSA) agent. VP-4556 exhibits significant microbial growth inhibition toward Staphylococcus aureus (ATCC 43300) with MIC of 8 µg/mL. VP-4556 inhibits the growth of methicillin‐resistant Staphylococcus aureus with growth inhibition >95%. |
|
DC71466 |
EDA-DA
Featured
|
EDA-DA is an unnatural dipeptide building block (an ethynyl-D-alanine and a D-alanine). It incorporates a biorthogonal alkyne group into peptidoglycan (PG) through MurF in the cytoplasmic pathway, which enables selective labeling via a click-chemistry reaction. EDA-DA allows labeling of PG in Gram-positive (B. subtilis), Gram-negative (E. coli and C. trachomatis), Mycobacterium (M. smegmatis) and moss plastids (P. patens) with azide modified fluorescent dyes such as Alexa Fluor 488. |
|
DC71467 |
PXYC13 |
PXYC13 is a ribosomal protein S1 (RpsA) antagonist with Kds of 7.61 and 8.50 μM for RpsA-CTD and RpsA-CTD Δ438A, respectively. RpsA plays an important role in the trans-translation process of Mycobacterium Tuberculosis (Mtb). |
|
DC71468 |
PXYC2 |
PXYC2 is a ribosomal protein S1 (RpsA) antagonist with Kds of 6.35 and 5.11 μM for RpsA-CTD and RpsA-CTD Δ438A, respectively. RpsA plays an important role in the trans-translation process of Mycobacterium Tuberculosis (Mtb). |
|
DC71469 |
PXYC1 |
PXYC1 is a ribosomal protein S1 (RpsA) antagonist with Kds of 0.81 and 0.31 μM for RpsA-CTD and RpsA-CTD Δ438A, respectively. RpsA plays an important role in the trans-translation process of Mycobacterium Tuberculosis (Mtb). |
|
DC71470 |
PXYD3 |
PXYD3 is a ribosomal protein S1 (RpsA) antagonist with Kds of 5.66 and 6.91 μM for RpsA-CTD and RpsA-CTD Δ438A, respectively. RpsA plays an important role in the trans-translation process of Mycobacterium Tuberculosis (Mtb). |
|
DC71471 |
ADG-2e |
ADG-2e is a potent antibacterial agent with MICs of 16, 4, 2, and 2 μg/mL for E. coli [KCTC 1682], P. aeruginosa [KCTC 1637], B.subtilis [KCTC 3068], and S. aureus [KCTC 1621], respectively. ADG-2e shows anti-metastatic activity against breast cancer cells. |
|
DC71472 |
Tibezonium iodide |
Tibezonium iodide, an oropharyngeal disinfectant, has antibacterial activity for the prevention of mouth infections. |
|
DC71473 |
LA-Bac8c |
LA-Bac8c is a Lipoic acid modified antimicrobial peptide with enhanced antimicrobial properties. LA-Bac8c inhibits S. aureus, MRSA, S. epidermidis, E. coli, and P. aeruginosa with MICs of 1, 4, 8, 8, and 8 μg/mL. |
|
DC71474 |
VP-4604
Featured
|
VP-4604 is a potent anti-methicillin-resistant Staphylococcus aureus (MRSA) agent. VP-4604 exhibits significant microbial growth inhibition toward Staphylococcus aureus (ATCC 43300) with MIC of 4-8 µg/mL. VP-4604 inhibits the growth of methicillin‐resistant Staphylococcus aureus with growth inhibition >95%. |
|
DC71475 |
PXYD4 |
PXYD4 is a ribosomal protein S1 (RpsA) antagonist with Kds of 3.24 and 1.64 μM for RpsA-CTD and RpsA-CTD Δ438A, respectively. RpsA plays an important role in the trans-translation process of Mycobacterium Tuberculosis (Mtb). |
|
DC71476 |
Callophycin A |
Callophycin A, red seaweed derived metabolite, is potently against C. albicans. Callophycin A exhibits potent activity against drug resistance vaginal candidiasis. |
|
DC71477 |
Prussian blue insoluble |
Prussian blue insoluble (Iron(III) ferrocyanide) is a good adsorbent to be used as antidotes for poisoning with cesium or thallium ions. Prussian blue insoluble (Iron(III) ferrocyanide) has anticancerous and antibacterial properties. Prussian blue insoluble (Iron(III) ferrocyanide) can be used as a contrast agent in photoacoustic and magnetic resonance imaging (MRI). Prussian blue insoluble can be used for contrast agents, antidotes and cancer research. |
|
DC71478 |
Methicillin sodium hydrate |
Methicillin sodium hydrate is a narrow-spectrum β-lactam antibiotic, acts by inhibiting penicillin-binding proteins (PBPs). Methicillin sodium hydrate is active against Staphylococcus aureus and Staphylococcus epidermidis that are resistant to other penicillins. Methicillin sodium hydrate can be used for the research of skin infections, osteomyelitis, and endocarditis. |
|
DC71479 |
(1R)-Tenofovir amibufenamide |
(1R)-Tenofovir amibufenamide ((1R)-HS-10234) is the isomer of Tenofovir amibufenamide, is an orally active antiviral agent. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) is a HIV infection inhibitor and HBV infection inhibitor. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) can be used for HIV infections, hepatitis B research. |
|
DC71480 |
Canocapavir |
Canocapavir (ZM-H1505R) has orally antiviral activity. Canocapavir is a HBV capsid inhibitor that can be used in the research of Chronic hepatitis B. . |
|
DC71481 |
Bepirovirsen
Featured
|
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC). |
|