Home > Inhibitors & Agonists > Antibiotics and Antivirals

Antibiotics and Antivirals

You can also try the following methods, and our professionals will serve you Customized Consultation
Cat. No. Product Name Field of Application Chemical Structure
DC71275 Sulconazole Sulconazole is a potent antifungal agent in the imidazole class. Sulconazole blocks the NF-κB/IL-8 signaling pathway and CSC (Cancer stem cells) formation. Sulconazole inhibits tumor growth, and can be used for breast cancer research.
DC71276 WRNA10 WRNA10 is a potent HIV-1 TAR RNA binder with an IC50 of 10 µM and an CC50 of 40 µM.
DC71277 CI-39 CI-39 is an antiviral natural product. CI-39 is an NNRTI (non-nucleoside reverse transcriptase inhibit) antiviral agent with an EC50 of 3.40 µM and an CC50 of >30 µM for wild type HIV-1. CI-39 inhibits HIV-1 RT DNA polymerase and ribonuclease H activitiessup.
DC71278 A3N19 A3N19 is a potent HIV-1 non-nucleoside reverse transcriptase inhibitor, with an EC50 of 3.28 nM against HIV-1 IIIB.
DC71279 MMV687807 MMV687807 is an anthelmintic agent which has a good activity against Toxoplasma gondii (T. gondii) with an IC50 value of 0.15 μM and a CC50 value of 1.69 μM.
DC71280 Coronastat Coronastat is a potent inhibitor of the SARS-CoV-2 3CL protease. The SARS-CoV-2 3CL protease is a critical drug target for small molecule COVID-19, given its likely druggability and essentiality in the viral maturation and replication cycle.
DC71281 FWM-1 FWM-1 is a potent SARS-COV-2 NSP13 helicase enzyme inhibitor with binding free energy equals -328.6 kcal/mol. FWM-1 effectively disrupts the binding of ATP to the SARS-COV2 helicase enzyme.
DC71282 Fmoc-leucine-15N Fmoc-leucine-15N is a 15N-labeled and 13C-labled EIDD-1931. EIDD-1931 (Beta-d-N4-hydroxycytidine; NHC) is a novel nucleoside analog and behaves as a potent anti-virus agent. EIDD-1931 effectively inhibits the replication activity of venezuelan equine ence
DC71283 FWM-4 FWM-4 is a potent SARS-COV-2 NSP13 helicase enzyme inhibitor.
DC71284 FWM-5 FWM-5 is a potent NSP13 helicase inhibitor. SARS-COV-2 NSP13 helicase enzyme plays crucial role in the virus life cycle. FWM-5 has the potential for the research of infection diseases.
DC71462 CRS3123 dihydrochloride CRS3123 (REP-3123) dihydrochloride, a fully synthetic antibacterial agent, potently inhibits methionyl-tRNA synthetase (MetRS) of Clostridioides difficile, inhibiting Clostridioides difficile toxin production and spore formation. CRS3123 dihydrochloride is an oral agent for the research of Clostridioides difficile infection (CDI).
DC71463 WX-081 Featured WX-081, an anti-tuberculosis agent, displays excellent anti-mycobacterial activity against M. tuberculosis H37Rv and low cytotoxicity.
DC71464 PXYC12 PXYC12 is a ribosomal protein S1 (RpsA) antagonist with Kds of 2.67 and 4.67 μM for RpsA-CTD and RpsA-CTD Δ438A, respectively. RpsA plays an important role in the trans-translation process of Mycobacterium Tuberculosis (Mtb).
DC71465 VP-4556 VP-4556 is a potent anti-methicillin-resistant Staphylococcus aureus (MRSA) agent. VP-4556 exhibits significant microbial growth inhibition toward Staphylococcus aureus (ATCC 43300) with MIC of 8 µg/mL. VP-4556 inhibits the growth of methicillin‐resistant Staphylococcus aureus with growth inhibition >95%.
DC71466 EDA-DA Featured EDA-DA is an unnatural dipeptide building block (an ethynyl-D-alanine and a D-alanine). It incorporates a biorthogonal alkyne group into peptidoglycan (PG) through MurF in the cytoplasmic pathway, which enables selective labeling via a click-chemistry reaction. EDA-DA allows labeling of PG in Gram-positive (B. subtilis), Gram-negative (E. coli and C. trachomatis), Mycobacterium (M. smegmatis) and moss plastids (P. patens) with azide modified fluorescent dyes such as Alexa Fluor 488.
DC71467 PXYC13 PXYC13 is a ribosomal protein S1 (RpsA) antagonist with Kds of 7.61 and 8.50 μM for RpsA-CTD and RpsA-CTD Δ438A, respectively. RpsA plays an important role in the trans-translation process of Mycobacterium Tuberculosis (Mtb).
DC71468 PXYC2 PXYC2 is a ribosomal protein S1 (RpsA) antagonist with Kds of 6.35 and 5.11 μM for RpsA-CTD and RpsA-CTD Δ438A, respectively. RpsA plays an important role in the trans-translation process of Mycobacterium Tuberculosis (Mtb).
DC71469 PXYC1 PXYC1 is a ribosomal protein S1 (RpsA) antagonist with Kds of 0.81 and 0.31 μM for RpsA-CTD and RpsA-CTD Δ438A, respectively. RpsA plays an important role in the trans-translation process of Mycobacterium Tuberculosis (Mtb).
DC71470 PXYD3 PXYD3 is a ribosomal protein S1 (RpsA) antagonist with Kds of 5.66 and 6.91 μM for RpsA-CTD and RpsA-CTD Δ438A, respectively. RpsA plays an important role in the trans-translation process of Mycobacterium Tuberculosis (Mtb).
DC71471 ADG-2e ADG-2e is a potent antibacterial agent with MICs of 16, 4, 2, and 2 μg/mL for E. coli [KCTC 1682], P. aeruginosa [KCTC 1637], B.subtilis [KCTC 3068], and S. aureus [KCTC 1621], respectively. ADG-2e shows anti-metastatic activity against breast cancer cells.
DC71472 Tibezonium iodide Tibezonium iodide, an oropharyngeal disinfectant, has antibacterial activity for the prevention of mouth infections.
DC71473 LA-Bac8c LA-Bac8c is a Lipoic acid modified antimicrobial peptide with enhanced antimicrobial properties. LA-Bac8c inhibits S. aureus, MRSA, S. epidermidis, E. coli, and P. aeruginosa with MICs of 1, 4, 8, 8, and 8 μg/mL.
DC71474 VP-4604 Featured VP-4604 is a potent anti-methicillin-resistant Staphylococcus aureus (MRSA) agent. VP-4604 exhibits significant microbial growth inhibition toward Staphylococcus aureus (ATCC 43300) with MIC of 4-8 µg/mL. VP-4604 inhibits the growth of methicillin‐resistant Staphylococcus aureus with growth inhibition >95%.
DC71475 PXYD4 PXYD4 is a ribosomal protein S1 (RpsA) antagonist with Kds of 3.24 and 1.64 μM for RpsA-CTD and RpsA-CTD Δ438A, respectively. RpsA plays an important role in the trans-translation process of Mycobacterium Tuberculosis (Mtb).
DC71476 Callophycin A Callophycin A, red seaweed derived metabolite, is potently against C. albicans. Callophycin A exhibits potent activity against drug resistance vaginal candidiasis.
DC71477 Prussian blue insoluble Prussian blue insoluble (Iron(III) ferrocyanide) is a good adsorbent to be used as antidotes for poisoning with cesium or thallium ions. Prussian blue insoluble (Iron(III) ferrocyanide) has anticancerous and antibacterial properties. Prussian blue insoluble (Iron(III) ferrocyanide) can be used as a contrast agent in photoacoustic and magnetic resonance imaging (MRI). Prussian blue insoluble can be used for contrast agents, antidotes and cancer research.
DC71478 Methicillin sodium hydrate Methicillin sodium hydrate is a narrow-spectrum β-lactam antibiotic, acts by inhibiting penicillin-binding proteins (PBPs). Methicillin sodium hydrate is active against Staphylococcus aureus and Staphylococcus epidermidis that are resistant to other penicillins. Methicillin sodium hydrate can be used for the research of skin infections, osteomyelitis, and endocarditis.
DC71479 (1R)-Tenofovir amibufenamide (1R)-Tenofovir amibufenamide ((1R)-HS-10234) is the isomer of Tenofovir amibufenamide, is an orally active antiviral agent. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) is a HIV infection inhibitor and HBV infection inhibitor. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) can be used for HIV infections, hepatitis B research.
DC71480 Canocapavir Canocapavir (ZM-H1505R) has orally antiviral activity. Canocapavir is a HBV capsid inhibitor that can be used in the research of Chronic hepatitis B. .
DC71481 Bepirovirsen Featured Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

Customized Consultation X

Your information is safe with us. * Required Fields.

Your name
Company
Email
Procuct Name
Cat. No.
Remark
Verification code
Please fill out the characters in the picture
X