Home > Products > Featured products

Featured products

You can also try the following methods, and our professionals will serve you Customized Consultation
Cat. No. Product Name Field of Application Chemical Structure
DC71335 Norastemizole Featured Tecastemizole (Norastemizole), a major metabolite of Astemizole, is a potent and selective H1 receptor antagonist. Tecastemizole shows anti-inflammatory activities.
DC71342 VU0469650 Featured VU0469650 is a potent, selective and CNS-penetrated negative allosteric modulator of mGlu1 receptor, with an IC50 of 99 nM.
DC71352 Picotamide Featured Picotamide is a combined inhibitor of thromboxane A2 (TxA2) synthase and receptor. Picotamide has antiplatelet activity. Picotamide promotes the reduction of microalbuminuria and the inhibition of growth of carotid plaques in diabetes. Picotamide can be used for researching acute or chronic cardiovascular diseases.
DC71359 UR-MB108 Featured UR-MB108 (Compound 57) is a potent, selective ABCG2 (BCRP) inhibitor with an IC50 of 79 nM. UR-MB108 is stable in blood plasma.
DC71365 BZAD-01 Featured BZAD-01 is a potent, selective and orally active inhibitor of NMDA NR2B subunit, with a Ki of 72 nM. BZAD-01 can improve postural asymmetry as well as Apomorphine-induced rotation.
DC71376 ABBV-318 Featured ABBV-318 is a potent Nav1.7/ Nav1.8 blocker, with IC50s of 2.8 μM and 3.8 μM for hNav1.7 and hNav1.8, respectively. ABBV-318 can be used for the research of pain.
DC71386 (2E)-OBAA Featured (2E)-OBAA is a potent phospholipase A2 (PLA2) inhibitor, with an IC50 of 70 nM. (2E)-OBAA induces apoptosis of HUVEC cells. (2E)-OBAA blocks Melittin-induced Ca2+ influx in Trypanosoma brucei, with an IC50 of 0.4 μM.
DC71390 Ribavirin carboxylic acid Featured Ribavirin carboxylic acid (TR-COOH) is a metabolite of ribavirin, ribavirin has strong antiviral activity.
DC71417 YSK 05 Featured YSK 05 is a pH-sensitive cationic lipid. YSK 05 improves the intracellular trafficking of non-viral vectors. YSK 05-MEND shows significantly good gene silencing activity and hemolytic activity. YSK 05 overcomes the suppression of endosomal escape by PEGylation. YSK 05 effectively enhances siRNA delivery both in vitro and in vivo.
DC71418 BPC157 Featured BPC157 (Bepecin, PL 14736), a small, chemically synthesised pentadecapeptide and a partial sequence of the human gastric juice protein BPC, which has been shown to be safe in clinical trials for inflammatory bowel disease and may be able to cure intestinal anastomosis dehiscence.
DC71430 NHS-NH-(diethylamino)ethyl benzoate Featured NHS-NH-(diethylamino)ethyl benzoate is a compound that can be used for N-glycan labeling.
DC71440 FAP-2286 Featured FAP-2286 is a highly promising FAP-targeting theranostic agent with potent affinity for FAP, versatile radionuclide coupling capabilities, and demonstrated antitumor activity. Its ability to serve as both a diagnostic imaging agent and a therapeutic tool makes it a valuable asset in oncology, particularly for cancers with prominent stromal involvement. As research progresses, FAP-2286 has the potential to significantly advance cancer diagnosis, treatment, and research, offering new hope for patients with FAP-expressing tumors.
DC71463 WX-081 Featured WX-081, an anti-tuberculosis agent, displays excellent anti-mycobacterial activity against M. tuberculosis H37Rv and low cytotoxicity.
DC71466 EDA-DA Featured EDA-DA is an unnatural dipeptide building block (an ethynyl-D-alanine and a D-alanine). It incorporates a biorthogonal alkyne group into peptidoglycan (PG) through MurF in the cytoplasmic pathway, which enables selective labeling via a click-chemistry reaction. EDA-DA allows labeling of PG in Gram-positive (B. subtilis), Gram-negative (E. coli and C. trachomatis), Mycobacterium (M. smegmatis) and moss plastids (P. patens) with azide modified fluorescent dyes such as Alexa Fluor 488.
DC71474 VP-4604 Featured VP-4604 is a potent anti-methicillin-resistant Staphylococcus aureus (MRSA) agent. VP-4604 exhibits significant microbial growth inhibition toward Staphylococcus aureus (ATCC 43300) with MIC of 4-8 µg/mL. VP-4604 inhibits the growth of methicillin‐resistant Staphylococcus aureus with growth inhibition >95%.
DC71481 Bepirovirsen Featured Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
DC71510 Ansofaxine hydrochloride Featured Ansofaxine hydrochloride (LY03005, LPM570065), a triple reuptake inhibitor, inhibits serotonin, dopamine and norepinephrine reuptake with IC50 values of 723, 491 and 763 nM, respectively.
DC71536 FABPs ligand 6 Featured FABPs ligand 6 (MF6) is an FABP5 and FABP7 inhibitor with KD values of 874 nM and 20 nM, respectively. FABPs ligand 6 can be used for multiple sclerosis research.
DC71542 2-MPPA Featured 2-MPPA (GPI-5693) is an orally active and selective glutamate carboxypeptidase II (GCP II; PSMA) inhibitor with an IC50 of 90 nM.
DC71559 IZTZ-1 Featured IZTZ-1, an imidazole-benzothiazole conjugate, is a c-MYC G4 ligand. IZTZ-1 is able to downregulate the c-MYC expression by stabilizing c-MYC G4. IZTZ-1 induces cell cycle arrest, apoptosis, thereby inhibiting cell proliferation in B16 cells. IZTZ-1 shows antitumor activity, and can be used for melanoma research.
DC71577 Haloperidol lactate Featured Haloperidol lactate is a potent antipsychotic agent. Haloperidol lactate can be used in acute and chronic schizophrenia and gilles de la tourette's syndrome. Haloperidol lactate has the potential for the research of psychotic disorders.
DC60208 NSC 31153 Featured
DC60209 NSC 31152 Featured
DC80035 WAY-647802 Featured WAY-647802 is a CDK inhibitor.
DC80036 ZINC36395841(compound 25) Featured ZINC36395841 is a small-molecule binder of the m6A-reader domain of YTHDC1.
DC80040 MS8511 Featured MS8511 is a highly potent, selective, and cell-active covalent inhibitor of G9a (Kd=44 nM) and GLP (Kd=46 nM). MS8511 could be a useful chemical tool for investigating the physiological and pathophysiological functions of G9a and GLP.
DC60211 TCL053 Featured TCL053 is an ionizable amino lipid.1 It has been used in the generation of lipid nanoparticles (LNPs) and has a pKa value of 6.8. LNPs containing TCL053 and encapsulating mRNA encoding the Cas9 nuclease, in combination with LNPs containing TCL053 and encapsulating single-guide RNA (sgRNA) targeting the Rosa26 locus, have been used to induce CRISPR-mediated gene editing in the mouse gastrocnemius muscle.TCL053 is an ionizable lipid that has received FDA approval for preparing mRNA vaccines. It is a three-tailed ionizable lipid to overcome the disadvantage of nonrepeatable administration of AAV vectors. In addition, combined with limb perfusion administration, TCL053 iLNPs could transiently deliver CRISPR-Cas9 mRNA and sgRNA to multiple muscle tissues, reducing immunogenicity and increasing the safety of iLNPs. It is great progress for treating Duchenne muscular dystrophy and other diseases that require multiple doses.
DC60212 NT1-O14B Featured NT1-O14B is a tryptamine-containing cationic lipidoid.1 It has been used in combination with other lipids in the formation of lipid nanoparticles (LNPs). Intravenous administration of LNPs containing NT1-O14B and encapsulating antisense nucleotides against tau decreases tau brain levels in mice.
DC60213 DOTMA Featured N-[1-(2,3-Dioleyloxy)propyl]-N,N,N-trimethylammonium (DOTMA) is a cationic lipid.It has been used as a component in liposomes that can be used to encapsulate siRNA, microRNAs, and oligonucleotides and for gene transfection in vitro.
DC60215 Moderna Lipid 29 Featured Lipid 29 is an ionizable amino lipid (pKa = 6.91) from Moderna platform that has been used in combination with other lipids in the formation of lipid nanoparticles (LNPs).Administration of human erythropoietin (EPO) mRNA in lipid 29-containing LNPs increases serum EPO levels in mice.

Customized Consultation X

Your information is safe with us. * Required Fields.

Your name
Company
Email
Procuct Name
Cat. No.
Remark
Verification code
Please fill out the characters in the picture
X