| DC49883 |
L343 |
L-343 is an ionizable cationic lipidoid and can be used to synthetic liposomes for systemic delivery of RNAi therapeutics, Pka: 6.34.L343, with its sterically hindered tert-butyl esters, exhibited slower elimination from plasma and higher and more persistent levels in liver compared with L319. |
|
| DC49889 |
503O13
Featured
|
503O13 is a degradable lipid-like compound for siRNA delivery. |
|
| DC49907 |
5A2-SC8
Featured
|
5A2-SC8 is a dendrimer for miRNA delivery to late-stage liver tumors with low hepatotoxicity. 5A2-SC8 shows potent EC50 < 0.02 mg/kg (siRNA against FVII (siFVII)) in dose-response experiments, and well tolerated in separate toxicity studies in chronically ill mice bearing MYC-driven tumors. 5A2-SC8 is a degradable lipid-like compound (ester-based dendrimer) for small RNAs delivery.5A2-SC8, was obtained by screening a large library of more than 1500 ester-based dendrimers
containing ionizable amino groups, which have three
tertiary amine heads and five lipid tails. Based on this library,
the in vitro transfection efficiency of different formulations of
5A2-SC8 iLNPs was evaluated, discovering the optimal formulation
(5A2-SC8, DOPE, cholesterol, PEG at a molar ratio of
15:15:30:3) of 5A2-SC8 iLNPs for delivering fumarylacetoacetate
hydrolase (FAH) mRNA to liver.After the intravenous injection
via tail, the model mice of hepatorenal tyrosinemia type I
had strong FAH protein expression, which prevented
body weight loss and increased the survival rate of hepatorenal
tyrosinemia mice . In addition to introducing utility of
5A2-SC8 iLNPs for the therapeutic intervention, the 5A2-SC8
iLNPs containing DOTAP have been used to establish complex
mouse models via intravenous injection, including in situ liverspecific
cancer model and in situ lung-specific cancer model.
Based on this iLNPs delivery system, 5A2-SC8 induced model
construction method overcomes the time-consuming and costly
disadvantages of traditional animal models establishing methods,
including transgenesis and gene engineering in embryonic
stem cells. |
|
| DC49915 |
DSPG-Na
Featured
|
DSPG-Na is the component of liposomes for drug delivery. |
|
| DC49932 |
FTT5
Featured
|
FTT5 is a lipid-like compound for efficient delivery of long mRNAs in vivo. |
|
| DC49952 |
246C10
Featured
|
246C10 is a synthesized ionizable lipid. 246C10 can be formulated into lipid nanoparticles (LNPs) with dioleoylphosphatidylethanolamine (DOPE), cholesterol, and C16-PEG2000 ceramide (PEG-lipid) as well as mRNA. The lipid nanoparticle formulations can be used for mRNA delivery. To obtain iLNPs that could specifically target liver sinusoidal
endothelial cells (LSECs), six different ionizable lipids (241C10
to 246C10) were synthesized by an epoxide ring-opening
reaction with piperazine- or piperidine-containing amines.
Biodistribution and gene regulation of various iLNPs were
assessed in vivo, and the results showed that the 246C10
iLNPs (containing piperazine amine) had the highest luciferase
expression in the liver. When further analyzing the
246C10 iLNPs transfection efficiency in different types of liver
cells, it was found that tdTomato fluorescence was mainly concentrated
in hepatocytes, not in LSECs. Figure 6f shows that 80%
of hepatocytes are fluorescent, 40% of LSECs are fluorescent, and
20% of Kupffer cells are fluorescent. Due to the mannose receptor
on LSECs, mannose-PEG lipid was introduced into 246C10
iLNPs to alter the distribution of iLNPs in different liver cells. As
shown in Figure 6g, tdTomato fluorescence distribution was 15%
of hepatocytes, 70% of LSECs, and 15% of Kupffer cells, significantly
improved the ability of iLNPs to actively target LSECs.
In contrast, this work indirectly shows that the iLNPs with piperazine
head lipid are more able to deliver mRNA to the liver and
translate the target protein than the iLNPs with piperidine
head lipid. It is worth mentioning that the preparation buffer of 246C10
iLNPs could influence the encapsulation efficiency of mRNA.
With the addition of sodium chloride in the citrate buffer, the
encapsulation efficiency of CRISPR-Cas9 mRNA and sgRNA
was increased. These iLNPs were able to treat hemophilia safely,
without causing hepatotoxicity, the immune response induced by
Cas9 and off-target editing. |
|
| DC70008 |
CLinDMA |
CLinDMA, a cationic lipid, can cause inflammatory response. CLinDMA can be used for the synthesis LNP201. LNP201 is a liposome assembly for systemic delivery of siRNA. |
|
| DC70010 |
98N12-5
Featured
|
98N12-5 is an ionizable cationic lipid. It has been used in combination with other lipids in the generation of lipid nanoparticles (LNPs). LNPs containing 98N12-5 and encapsulating proprotein convertase subtilisin kexin type 9 (PCSK9) siRNA selectively accumulate in the liver and reduce total serum cholesterol levels in mice and rats and serum LDL levels in cynomolgus monkeys. |
|
| DC57086 |
CL4H6
Featured
|
CL4H6 is a pH-sensitive cationic lipid. CL4H6 is the main component of lipid nanoparticles (LNPs), which can be used to target and deliver siRNA, and induces a potent gene-silencing response[1][2].
|
|
| DC71034 |
EDMPC
Featured
|
EDMPC, a cationic lipid, has an enhanced ability to deliver DNA to pulmonary tissues. EDMPC mediates intralobar DNA delivery to rodents. |
|
| DC71118 |
SQDG
Featured
|
SQDG is a glycolipid that possesses sugar moieties in their head groups. SQDG is a membrane lipid that can be used to investigate the effects of structural lipid in LNP formulations. |
|
| DC80021 |
DSPE-PEG2000 Maleimide
Featured
|
DSPE-PEG-MAL is one of the reactive phospholipid PEG reagents that can react with sulfhydryl group (mercaptan, -SH). DSPE (1, 2-distearyl-Sn-glycerol 3-phosphate ethanolamine) is a highly hydrophobic saturated 18C phospholipid. |
|
| DC80023 |
DSPE-PEG2000-DBCO
Featured
|
DSPE-PEG-DBCO ammonium is the ammonium salt form of DSPE-PEG-DBCO. DSPE-PEG-DBCO ammonium is utilized in copper-free click chemistry through SPAAC conjugation with an azido-functionalized peptide ligand. DSPE-PEG-DBCO ammonium is applied in drug-delivery and nanoparticle research. |
|
| DC71417 |
YSK 05
Featured
|
YSK 05 is a pH-sensitive cationic lipid. YSK 05 improves the intracellular trafficking of non-viral vectors. YSK 05-MEND shows significantly good gene silencing activity and hemolytic activity. YSK 05 overcomes the suppression of endosomal escape by PEGylation. YSK 05 effectively enhances siRNA delivery both in vitro and in vivo. |
|
| DC71481 |
Bepirovirsen
Featured
|
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC). |
|
| DC60211 |
TCL053
Featured
|
TCL053 is an ionizable amino lipid.1 It has been used in the generation of lipid nanoparticles (LNPs) and has a pKa value of 6.8. LNPs containing TCL053 and encapsulating mRNA encoding the Cas9 nuclease, in combination with LNPs containing TCL053 and encapsulating single-guide RNA (sgRNA) targeting the Rosa26 locus, have been used to induce CRISPR-mediated gene editing in the mouse gastrocnemius muscle.TCL053 is an ionizable lipid that has received FDA approval
for preparing mRNA vaccines. It is a three-tailed ionizable lipid
to overcome the disadvantage of nonrepeatable administration of
AAV vectors. In addition, combined with limb perfusion administration,
TCL053 iLNPs could transiently deliver CRISPR-Cas9
mRNA and sgRNA to multiple muscle tissues, reducing
immunogenicity and increasing the safety of iLNPs. It is
great progress for treating Duchenne muscular dystrophy and
other diseases that require multiple doses. |
|
| DC60212 |
NT1-O14B
Featured
|
NT1-O14B is a tryptamine-containing cationic lipidoid.1 It has been used in combination with other lipids in the formation of lipid nanoparticles (LNPs). Intravenous administration of LNPs containing NT1-O14B and encapsulating antisense nucleotides against tau decreases tau brain levels in mice. |
|
| DC60213 |
DOTMA |
N-[1-(2,3-Dioleyloxy)propyl]-N,N,N-trimethylammonium (DOTMA) is a cationic lipid.It has been used as a component in liposomes that can be used to encapsulate siRNA, microRNAs, and oligonucleotides and for gene transfection in vitro. |
|
| DC60215 |
Lipid 29
Featured
|
Lipid 29 is an ionizable amino lipid (pKa = 6.91) that has been used in combination with other lipids in the formation of lipid nanoparticles (LNPs).Administration of human erythropoietin (EPO) mRNA in lipid 29-containing LNPs increases serum EPO levels in mice. |
|
| DC71699 |
DOIC |
DOIC is a cationic lipid that can be used for RNA vaccines. |
|
| DC80050 |
LIPID A6
Featured
|
Ionizable lipid A6 (di(dec-3-yn-1-yl) 9-((4-(dimethylamino) butanoyl)oxy) heptadecanedioate) was developed by modifying
the backbone structure of Dlin-MC3-DMA through introducing alkynyl and ester groups into the lipid tails. Alkyne lipid A6 demonstrated a significant improvement in transfection efficiency (~8.5, ~2.0, and ~2.5-fold higher than the original MC3, C12-200 and cKK-E12 containing LNPs, respectively).The performance
of the A6 coprepared into iLNPs with other amine-containing
lipid materials (cKKE12) was evaluated, and the molar ratio of
the formulation was changed to 35:16.0:46.5:2.5 (A6/cKKE12:
DOPE: Chol: PEG). The results showed that these formulations
synergistically facilitated more effective mRNA delivery and
improved tolerability following single and repeated dosing. It
was confirmed that albumin-associated macrophage phagocytosis
and endocytosis is an apolipoprotein-independent cellular
internalization pathway of iLNPs in the liver.
According to the fusion kinetics, the lipids with highfrequency
tail protrusion and high lateral diffusion coefficient
can perturb and trigger membrane sprouting, which in turn promotes
membrane fusion. The application of iLNPs with those
lipids (such as A6) may be an effective method to further enhance
the release of mRNA in vivo. |
|
| DC80065 |
113-O12B
Featured
|
113-O12B is a disulfide bond-containing ionizable cationic lipidoid. 113-O12B LNP, an LN-targeting LNP delivery system, is developed for a mRNA cancer vaccine. The 113-O12B/mRNA shows enhanced expression in APCs compared with ALC-0315/mRNA, indicating the LN-specific targeting ability. |
.gif)
|
| DC80066 |
306Oi10
Featured
|
306Oi10 is a branched-chain ionizable lipidoid and may be useful in the generation of lipid nanoparticles (LNPs). 306Oi10 ionizable lipids tail is isodecyl acrylate, affording the
lipid tail a carbon branch, which confers significant improvement of the mRNA deliver efficiency. Compared with the straight-tailed 306O10, the 306Oi10 with carbon branches at the lipid tail generates more powerful surface ionization at late endosomal pH of 5.0 to improve the delivery efficiency of mRNA. The studies showed that 306Oi10 iLNPs significantly promoted mRNA expression in liver (more than 10- fold).306Oi10 iLNPs could induce stronger protein expression
than two benchmark lipids, C12-200 and DLin-MC3-DMA. The
total organ protein expression produced by 306Oi10 iLNPs was
threefold higher than MC3 and over 20-fold higher expression
than C12-200. The 306Oi10 iLNPs could codeliver three distinct
mRNAs (luciferase, mCherry, and erythropoietin), or deliver
Cas9 mRNA and single guide RNA (sgRNA) separately.
Besides, 306Oi10 iLNPs have the potential of mRNA therapy
for hepatocellular carcinoma, because they could target
malignant hepatocytes, endothelial cells, and Kupffer cells
simultaneously. To enable 306Oi10 iLNPs to deliver mRNA to
extrahepatic organs, charged phospholipids were used in place
of neutral phospholipids. The substitution of DOPE with
DOTAP increased the positive surface charge of iLNPs at pH
7 about fivefold and changed the protein expression ratio of
liver/lung from 36:1 to 1:56. Similarly, the substitution of
DOPE with PS decreased the positive charge and changed the
protein expression ratio of liver/spleen from 8:1 to 1:3.
Further, the lung-target of DOTAP was better than that of neutral
or anionic lipids, which might reduce immune cells infiltration
in the lung. |
|
| DC80068 |
LIPID PL1 |
PL1 is a novel biomimetic phospholipid. PL1 nanoparticle delivery of costimulatory
receptor CD137 mRNA improved the immunotherapy with an
anti-CD137 Ab to some extent in both tumor models with better
results obtained in the B16F10 melanoma model as compared to
the A20 lymphoma model. |
|
| DC80069 |
OF-DEG-LIN |
OF-Deg-Lin is a biodegradable lipid containing an ester group, developed from the nonbiodegradable, linoleic acid derived OF-02; mRNA-LNPs containing OF-Deg-Lin showed high expression in the spleen. The ionizable lipid Of-Deg-Lin was synthesized,
which possessed the similar chemical structure with OF-02.Both Of-Deg-Lin and OF-02 had diketopiperazine core and
doubly unsaturated tails, and the difference between them
was that Of-02 contained nondegradable 1,2-amino-alcohol linkages,
whereas Of-Deg-Lin contained degradable ester linkages The change of linker altered iLNPs distribution
and mRNA expression in vivo. Although the Of-Deg-Lin iLNPs
could accumulate in the liver and spleen, they induced the
expression of most functional proteins in B lymphocytes of
spleen (over 85% of the total protein), not in the liver.
Of-Deg-Lin iLNPs can deliver mRNA and express functional
proteins in the spleen specifically, but the mechanism
is unclear. |
|
| DC80070 |
A2-Iso5-2DC18
Featured
|
A2-Iso5-2DC18 is a top-performing lipid for mRNA delivery in bone marrow-derived dendritic cells (BMDCs), BMDMs and HeLa cells. |
|
| DC80071 |
A18-ISO5-2DC18 (Pimidol)
Featured
|
A18-Iso5-2DC18 that could not only deliver mRNA vaccines robustly but also activate the stimulator
of interferon genes (STING) pathway. A18-Iso5-2DC18 strongly binds to the stimulator of interferon genes (STING) and induces potent cytolytic T lymphocyte responses, resulting in substantial antitumor immunity (Miao et al. 2019). |
|
| DC80072 |
306-O12B (Triscormin)
Featured
|
306-O12B is a cationic lipidoid.306-O12B LNP is more efficient than MC-3 LNP in inducing loss-of-function mutations in Angptl3 through CRISPR-Cas9-based genome editing. It has been used in the generation of lipid nanoparticles (LNPs). Intravenous administration of LNPs containing 306-O12B and encapsulating an mRNA reporter accumulate specifically in the mouse liver. LNPs containing 306-O12B and encapsulating mRNA encoding the Cas9 nuclease (mCas9) and single-guide RNA targeting Angptl3 (sgAngptl3), the gene encoding angiopoietin-related protein 3, have been used to induce CRISPR-mediated gene knockdown in mice resulting in a reduction of serum Angptl3 protein, LDL, and triglyceride levels. A novel ionizable lipids library was constructed by a combinatory solvent-free Michael addition reaction between disulfide bondincorporated acrylate lipid tails and amine-containing heads. In this library, the tail-branched bioreducible ionizable lipid 306-O12B was screened out. Due to the presence of special ester bonds and branches in lipid tails, the accumulation of iLNPs in the liver was increased, and endosome escape was prompted. These iLNPs were used to deliver CRISPR-Cas9 mRNA and sgRNA targeting to angiopoietin-like 3 (Angptl3). Compared with FDA-approved MC3, 306-O12B induced more specific and efficient Angptl3 gene knockout in the liver, resulting in significant decrease in the levels of serum Angptl3 protein, low-density lipoprotein cholesterol (LDL-C), and triglyceride. According to the molecular shape hypothesis outlined several decades ago, the increase of branches can create ionizable lipids with more cone-shaped structure to enhance the destructiveness of the membrane structure of the endosome and increase mRNA release. However, it is unknown whether the structural stability of iLNPs will be sacrificed with the increase of branches. The optimal branches and chain length need to be further explored. |
|
| DC80080 |
OF-C4-Deg-Lin
Featured
|
OF-C4-Deg-Lin is a novel ionizable lipid for RNA delivery. OF-C4-Deg-Lin LNPs entrapping mRNA coding for luciferase induce the majority of protein expression in the spleen, with minimal translation in the liver, and negligible translation in other organs. OF-C4-Deg-Lin LNPs entrapping mRNA coding for luciferase induce the majority of protein expression in the spleen, with minimal translation in the liver, and negligible translation in other organs. To improve the mRNA delivery to extrahepatic tissues, a series of degradable diketopiperazine-based ionizable lipids were synthesized. Through evaluating the mRNA functional activity delivered by iLNPs, it was found that the ionizable lipids with
doubly unsaturated lipid tails and linkers containing a length of four carbon aliphatic chain (Of-C4-Deg-Lin) could deliver the mRNA more efficiently. Moreover, compared with cKK-E12 and Invivofectamine, Of-C4-Deg-Lin could specifically induce more than 85% of firefly luciferase expression in spleen,minimal expression in the liver, and insignificant expression in other tissues. |
|
| DC71975 |
TriGalNAc CBz
Featured
|
TriGalNAc CBz is a GalNAc derivative and tri-GalNAc is an asialoglycoprotein receptor (ASGPR) ligand. TriGalNAc CBz can be used for mRNA drug delivery as well as lysosomal targeted chimerism (LYTAC) studies. |
|
