HBV-IN-11 is a potent HBsAg secretion inhibitor with an EC50 of 0.46 µM (From patent WO2018085619A1, example 28).

HBV-IN-8 is a potent HBV inhibitor with an EC50 of 287.9 nM (WO2021213445A1, compound 13).

HBV-IN-9 is a potent HBsAg (HBV Surface antigen) inhibitor (IC50=10 nM) and HBV DNA production inhibitor (IC50=0.15 nM in HepG2.2.15 cells). From patent WO2018001952A1, example 20.

HBV-IN-12 is a potent hepatitis B surface antigen (HBsAg) inhibitor. From patent WO2021204252A1, compound 1_B.

HBV-IN-6 is a potent HBV inhibitor with an EC50 of 44 nM (WO2021213445A1, compound 3).

(5S,8R)-HBV-IN-10 is an enantiomer of compound 6 (WO2021204258A1). Compound 6 is a hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC50 ≤0.05 μM). From patent WO2021204258A1, compound 6.

HBV-IN-10 is an enantiomer of compound 6 (WO2021204258A1). Compound 6 is a hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC50 ≤0.05 μM). From patent WO2021204258A1, compound 6.

HBV-IN-12 is a potent hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC50 ≤0.05 μM). HBV-IN-12 shows anti-HBV DNA activity (0.001 μM＜EC50 ≤0.02 μM). From patent WO2021204252A1, compound 15.

TLR8 agonist 4 showed effective inhibition on wild-type and drug-resistant (lamivudine and entecavir) HBV strains. The IC50 values are 0.15 and 0.10 respectively μM.

BA38017 is a potent HBV core protein assembly modulator. BA38017 inhibits HBV replication with an EC50 of 0.20 μM.

HBV-IN-17 (compound 8) is a potent HBV capsid assembly modulator with an EC50 of 511 nM.

SHR5133 is a highly potent, orally active HBV capsid assembly modulator. SHR5133 displays HBV DNA reduction (EC50=26.6 nM).

HBV-IN-16 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-16 is a quinoline derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2019121357A1, compound 1).

HBV-IN-14 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-14 is a pyridinopyrimidinones compound. HBV-IN-14 has the potential for the research of HBV infection (extracted from patent WO2021190502A1, compound 5).

AB-452 (AB452) is a potent, small molecule inhibitor of noncanonical poly(A) polymerases PAPD5 and PAPD7 (PAPD5/7), inhibits PAPD5/7 enzymatic activities, reduces HBsAg in vitro (EC50=1.4/6.8 nM).AB-452 demonstrated specific antiviral activity for HBV, was inactive against a panel of 10 different RNA and DNA viruses with EC50 values of >30 uM.AB-452 reduced HBsAg, HBeAg, and HBV DNA production with EC50 of 0.28-6.8 nM, without cytotoxicity.AB-452 interferes with multiple steps of HBV life cycle by reducing HBV RNA.AB-452 demonstrated antiviral activity in AAV-HBV-transduced mouse model.AB-452 promotes HBV RNA degradation through inhibiting PAPD5 and PAPD7 enzymatic activities and blockage of guanosine incorporation into viral RNA poly(A) tails..

AB-506 is a small-molecule inhibitor targeting HBV core protein, inhibits viral replication in vitro (IC50=77 nM).AB-506 binds to HBV core protein, accelerates capsid assembly and inhibits HBV pgRNA encapsidation.AB-506 blocks cccDNA establishment in HBV-infected HepG2-hNTCP-C4 cells and primary human hepatocytes, leading to inhibition of viral RNA, HBsAg, and HBeAg production (EC50=0.64-1.52 uM).AB-506 demonstrated activity across HBV genotypes A-H and maintains antiviral activity against nucleostide analog-resistant variants in vitro.AB-506 showed an 8 to 20-fold increase in EC50 values against L30F, L37Q, and I105T substitutions.AB-506 exhibits good oral bioavailability, systemic exposure, and higher liver to plasma ratios in rodents.

Rencofilstat (CRV431) is a non-immunosuppressive analogue of cyclosporine A and pan-cyclophilin inhibitor, potently inhibits cyclophilin isoforms A, B, D, and G with IC50 of 1-7 nM.Rencofilstat (CRV431) is more than 13 times more potent than the parent compound, cyclosporine A (CsA).Rencofilstat (CRV431) inhibits liver HBV DNA and HBsAg, reduces liver HBV DNA levels and moderately decreased serum HBsAg levels in HBV transgenic mouse model.Rencofilstat (CRV431) shows potential as a drug candidate for chronic liver diseases.

(1R)-Tenofovir amibufenamide ((1R)-HS-10234) is the isomer of Tenofovir amibufenamide, is an orally active antiviral agent. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) is a HIV infection inhibitor and HBV infection inhibitor. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) can be used for HIV infections, hepatitis B research.

Canocapavir (ZM-H1505R) has orally antiviral activity. Canocapavir is a HBV capsid inhibitor that can be used in the research of Chronic hepatitis B. .

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

(-)-5′-Noraristeromycin is an antiviral agent. (-)-5′-Noraristeromycin also is an enantiomer of 5'-noraristeromycin and can inhibit intracellular HBV replication and virion production. (-)-5′-Noraristeromycin can be used for the research of cancer.

AB-836 is an orally active HBV capsid inhibitor. AB-836 inhibits viral replication by interacting with HBV core protein.