AB-423 is the first-generation Hepatitis B Virus Capsid Assembly inhibitor, which was generally safe and well tolerated in Phase 1 healthy volunteer studies.

BAY 41-4109 is a potent inhibitor of human hepatitis B virus (HBV) with an IC50 of 53 nM.

BAY 41-4109 racemate is a potent inhibitor of human hepatitis B virus (HBV) with an IC50 of 53 nM.

GLP-26 is a novel potent HBV capsid modulator that reduces secreted HBeAg in HepNTCPDL cells transfected with HBV wild type with EC50 of 0.7 uM.

JNJ-632 is a novel and potent inhibitor of HBV replication in vitro across genotypes A-D.

NTCP binder peptide WD1 is a macrocyclic peptide, pan-genotypic inhibitor of HBV cellular entry via targeting the cell-surface receptor for HBV, sodium taurocholate cotransporting polypeptide (NTCP, Kd=15 nM), reduces HBs antigen levels in culture supernatants.

NTCP binder peptide WL4 is a macrocyclic peptide, pan-genotypic inhibitor of HBV cellular entry via targeting the cell-surface receptor for HBV, sodium taurocholate cotransporting polypeptide (NTCP, Kd=42 nM), reduces HBs antigen levels in culture supernatants with IC50 of 0.66 uM.

Adefovir (GS-0393) is an adenosine monophosphate analog antiviral agent that after intracellular conversion to Adefovir diphosphate inhibits HBV DNA polymerase. Adefovir has an IC50 of 0.7 μM against HBV in the HepG2.2.15 cell line. Adefovir has good antiviral activity against several viruses, including HBV and herpesviruses.

LB80317 is an active metabolite of LB80380 and suppresses the DNA synthesis of HBV with an EC50 of 0.5 μM. LB80317 has antiviral effect and has the potential for chronic hepatitis B treatment.

Sophoranol is an alkaloid that can be isolated from S. flavescens, with antiviral activity. Sophoranol has anti-HBV (hepatitis B virus) activity. Sophoranol shows potent antiviral activities against respiratory syncytial virus (RSV) with an IC50 of 10.4 μg/mL.

HBV-IN-4, a phthalazinone derivative, is a potent and orally active HBV DNA replication inhibitor with an IC50 of 14 nM. HBV-IN-4 induces the formation of genome-free capsids and has potent anti-HBV potencies.

ATI-2173 is a novel liver-targeted molecule designed to deliver the 5′-monophosphate of clevudine for the treatment of chronic hepatitis B infection.

Chamaechromone is a biflavonoid ingredient isolated from the roots of Stellera chamaejasme L. (Thymelaeaceae). Chamaechromone possesses anti-hepatitis B virus (HBV) effects against the surface antigen of HBV (HBsAg) secretion and has insecticidal activities.

Schisanwilsonin C (Arisanschinin K) shows anti-HBV activity.

LPRP-Et-97543 is a potent anti-HBV agent. LPRP-Et-97543 reduces Core, S, and preS but not X promoter activities. LPRP-Et-97543 can be used for acute and chronic HBV infections research.

Firzacorvir is a cyclic sulfamide compound and modulates HBV core protein. Firzacorvir has anti-HBV activity with EC50 < 1 μΜ.

Tenofovir amibufenamide (HS-10234), a Tenofovir prodrug, is an orally active antiviral agent. Tenofovir amibufenamide inhibits HBV, and can be used for chronic hepatitis B (CHB) study.

Bersacapavir is a novel Hepatitis B Virus capsid assembly modulator.

Vebicorvir (ABI-H0731) is a first-generation hepatitis B virus (HBV) core protein inhibitor. Vebicorvir (ABI-H0731) suppresses covalently closed circular DNA (cccDNA) formation in two de novo infection models with EC50s from 1.84 μM to 7.3 μM.

Inarigivir (ORI-9020) ammonium is a dinucleotide antiviral drug which can significantly reduce liver HBV DNA in transgenic mice expressing hepatitis B virus. Inarigivir (ORI-9020) act as an RIG-I agonist to activate cellular innate immune responses.

AB-729, a nucleoside analogue, is an RNA interference (RNAi). AB-729 conjugates to a trimer of N-acetylgalactosamine (GalNAc) ligand that promotes uptake into hepatocytes via the asialoglycoprotein receptor (ASGR). AB-729 inhibits viral replication and reduces HBV antigens.

HBV-IN-7 is a potent HBV inhibitor with an EC50 of 7 nM (WO2021213445A1, compound 5).

HBV-IN-11 is a potent HBsAg secretion inhibitor with an EC50 of 0.46 µM (From patent WO2018085619A1, example 28).

HBV-IN-8 is a potent HBV inhibitor with an EC50 of 287.9 nM (WO2021213445A1, compound 13).

HBV-IN-9 is a potent HBsAg (HBV Surface antigen) inhibitor (IC50=10 nM) and HBV DNA production inhibitor (IC50=0.15 nM in HepG2.2.15 cells). From patent WO2018001952A1, example 20.

HBV-IN-12 is a potent hepatitis B surface antigen (HBsAg) inhibitor. From patent WO2021204252A1, compound 1_B.

HBV-IN-6 is a potent HBV inhibitor with an EC50 of 44 nM (WO2021213445A1, compound 3).

(5S,8R)-HBV-IN-10 is an enantiomer of compound 6 (WO2021204258A1). Compound 6 is a hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC50 ≤0.05 μM). From patent WO2021204258A1, compound 6.

HBV-IN-10 is an enantiomer of compound 6 (WO2021204258A1). Compound 6 is a hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC50 ≤0.05 μM). From patent WO2021204258A1, compound 6.

HBV-IN-12 is a potent hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC50 ≤0.05 μM). HBV-IN-12 shows anti-HBV DNA activity (0.001 μM＜EC50 ≤0.02 μM). From patent WO2021204252A1, compound 15.

TLR8 agonist 4 showed effective inhibition on wild-type and drug-resistant (lamivudine and entecavir) HBV strains. The IC50 values are 0.15 and 0.10 respectively μM.

BA38017 is a potent HBV core protein assembly modulator. BA38017 inhibits HBV replication with an EC50 of 0.20 μM.

HBV-IN-17 (compound 8) is a potent HBV capsid assembly modulator with an EC50 of 511 nM.

SHR5133 is a highly potent, orally active HBV capsid assembly modulator. SHR5133 displays HBV DNA reduction (EC50=26.6 nM).

HBV-IN-16 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-16 is a quinoline derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2019121357A1, compound 1).

HBV-IN-14 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-14 is a pyridinopyrimidinones compound. HBV-IN-14 has the potential for the research of HBV infection (extracted from patent WO2021190502A1, compound 5).

AB-452 (AB452) is a potent, small molecule inhibitor of noncanonical poly(A) polymerases PAPD5 and PAPD7 (PAPD5/7), inhibits PAPD5/7 enzymatic activities, reduces HBsAg in vitro (EC50=1.4/6.8 nM).AB-452 demonstrated specific antiviral activity for HBV, was inactive against a panel of 10 different RNA and DNA viruses with EC50 values of >30 uM.AB-452 reduced HBsAg, HBeAg, and HBV DNA production with EC50 of 0.28-6.8 nM, without cytotoxicity.AB-452 interferes with multiple steps of HBV life cycle by reducing HBV RNA.AB-452 demonstrated antiviral activity in AAV-HBV-transduced mouse model.AB-452 promotes HBV RNA degradation through inhibiting PAPD5 and PAPD7 enzymatic activities and blockage of guanosine incorporation into viral RNA poly(A) tails..

AB-506 is a small-molecule inhibitor targeting HBV core protein, inhibits viral replication in vitro (IC50=77 nM).AB-506 binds to HBV core protein, accelerates capsid assembly and inhibits HBV pgRNA encapsidation.AB-506 blocks cccDNA establishment in HBV-infected HepG2-hNTCP-C4 cells and primary human hepatocytes, leading to inhibition of viral RNA, HBsAg, and HBeAg production (EC50=0.64-1.52 uM).AB-506 demonstrated activity across HBV genotypes A-H and maintains antiviral activity against nucleostide analog-resistant variants in vitro.AB-506 showed an 8 to 20-fold increase in EC50 values against L30F, L37Q, and I105T substitutions.AB-506 exhibits good oral bioavailability, systemic exposure, and higher liver to plasma ratios in rodents.

Rencofilstat (CRV431) is a non-immunosuppressive analogue of cyclosporine A and pan-cyclophilin inhibitor, potently inhibits cyclophilin isoforms A, B, D, and G with IC50 of 1-7 nM.Rencofilstat (CRV431) is more than 13 times more potent than the parent compound, cyclosporine A (CsA).Rencofilstat (CRV431) inhibits liver HBV DNA and HBsAg, reduces liver HBV DNA levels and moderately decreased serum HBsAg levels in HBV transgenic mouse model.Rencofilstat (CRV431) shows potential as a drug candidate for chronic liver diseases.

(1R)-Tenofovir amibufenamide ((1R)-HS-10234) is the isomer of Tenofovir amibufenamide, is an orally active antiviral agent. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) is a HIV infection inhibitor and HBV infection inhibitor. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) can be used for HIV infections, hepatitis B research.

Canocapavir (ZM-H1505R) has orally antiviral activity. Canocapavir is a HBV capsid inhibitor that can be used in the research of Chronic hepatitis B. .

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

(-)-5′-Noraristeromycin is an antiviral agent. (-)-5′-Noraristeromycin also is an enantiomer of 5'-noraristeromycin and can inhibit intracellular HBV replication and virion production. (-)-5′-Noraristeromycin can be used for the research of cancer.

AB-836 is an orally active HBV capsid inhibitor. AB-836 inhibits viral replication by interacting with HBV core protein.

DVR-01 is a HBV inhibitor with EC50 values of 1.7 and 1.6 μM in AML12HBV10 and HepDES19 cells, respectively. DVR-01 shows antiviral activity against drug-resistant HBV mutants with EC50s of 2.403-3.273 μM. DVR-01 can be used for the research of HBV infection and related diseases.

Lagociclovir valactate is a prodrug of Lagociclovir. Lagociclovir valactate is an orally active anti-HBV agent.

trans-ccc_R08 (compound 1-B) is a potent cccDNA (covalently closed circular DMA) inhibitor. trans-ccc_R08 inhibits HBeAg level with an IC50 value of 0.08 µM. trans-ccc_R08 has the potential for the research of Hepatitis B Virus infection (HBV).

cis-ccc_R08 (compound 1) is a flavonoid derivative that can be used in the study of hepatitis B virus (HBV) infection. cis-ccc_R08 is a cccDNA (covalently closed circular DNA) inhibitor.

ccc_R08 is a non-cytotoxic and orally active cccDNA inhibitor that reduces cccDNA levels in the liver of HBV-infected mice. ccc_R08 can be used in the study of HBV virus (hepatitis B virus) infection.

DF-006 is a small molecule, orally active Alpha-kinase 1 (ALPK1) agonist, activates ALPK1 and stimulates host innate immunity locally in liver, DF-006 enacts potent anti-HBV responses in mouse models of HBV and in primary human hepatocytes.

E-CFCP is a novel long-acting nucleotide reverse transcriptase inhibitor (NRTI) against HBV, shows potent activity against HBV WTD1 and HBV WTC2 with IC50 of 1.8 and 0.7 nM, respectively.

Neracorvir is a potent anti-HBV agent, targets HBV surface antigen.

SAG-524 (SAG524) is a potent and orally bioavailable small molecule inhibitor of HBV replication, reduces HBsAg and HBV-DNA (IC50 = 0.92 nM and 1.4 nM) by destabilizing HBV-RNA.

ZINC20451377 is a small molecule that binds to hepatitis B surface antigen (HBsAg) with high affinity (Kd=65.3 nM), reduces HBsAg levels and HBV virion secretion in cell culture model for HBV.