| DC49059 |
TLR8 agonist 4 |
TLR8 agonist 4 showed effective inhibition on wild-type and drug-resistant (lamivudine and entecavir) HBV strains. The IC50 values are 0.15 and 0.10 respectively μM. |
|
| DC49475 |
BA38017 |
BA38017 is a potent HBV core protein assembly modulator. BA38017 inhibits HBV replication with an EC50 of 0.20 μM. |
|
| DC49476 |
HBV-IN-17 |
HBV-IN-17 (compound 8) is a potent HBV capsid assembly modulator with an EC50 of 511 nM. |
|
| DC49477 |
SHR5133 |
SHR5133 is a highly potent, orally active HBV capsid assembly modulator. SHR5133 displays HBV DNA reduction (EC50=26.6 nM). |
|
| DC49478 |
HBV-IN-16 |
HBV-IN-16 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-16 is a quinoline derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2019121357A1, compound 1). |
|
| DC49479 |
HBV-IN-14 |
HBV-IN-14 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-14 is a pyridinopyrimidinones compound. HBV-IN-14 has the potential for the research of HBV infection (extracted from patent WO2021190502A1, compound 5). |
|
| DC70166 |
AB-452 |
AB-452 (AB452) is a potent, small molecule inhibitor of noncanonical poly(A) polymerases PAPD5 and PAPD7 (PAPD5/7), inhibits PAPD5/7 enzymatic activities, reduces HBsAg in vitro (EC50=1.4/6.8 nM).AB-452 demonstrated specific antiviral activity for HBV, was inactive against a panel of 10 different RNA and DNA viruses with EC50 values of >30 uM.AB-452 reduced HBsAg, HBeAg, and HBV DNA production with EC50 of 0.28-6.8 nM, without cytotoxicity.AB-452 interferes with multiple steps of HBV life cycle by reducing HBV RNA.AB-452 demonstrated antiviral activity in AAV-HBV-transduced mouse model.AB-452 promotes HBV RNA degradation through inhibiting PAPD5 and PAPD7 enzymatic activities and blockage of guanosine incorporation into viral RNA poly(A) tails.. |
|
| DC70167 |
AB-506 |
AB-506 is a small-molecule inhibitor targeting HBV core protein, inhibits viral replication in vitro (IC50=77 nM).AB-506 binds to HBV core protein, accelerates capsid assembly and inhibits HBV pgRNA encapsidation.AB-506 blocks cccDNA establishment in HBV-infected HepG2-hNTCP-C4 cells and primary human hepatocytes, leading to inhibition of viral RNA, HBsAg, and HBeAg production (EC50=0.64-1.52 uM).AB-506 demonstrated activity across HBV genotypes A-H and maintains antiviral activity against nucleostide analog-resistant variants in vitro.AB-506 showed an 8 to 20-fold increase in EC50 values against L30F, L37Q, and I105T substitutions.AB-506 exhibits good oral bioavailability, systemic exposure, and higher liver to plasma ratios in rodents. |
|
| DC70733 |
Rencofilstat |
Rencofilstat (CRV431) is a non-immunosuppressive analogue of cyclosporine A and pan-cyclophilin inhibitor, potently inhibits cyclophilin isoforms A, B, D, and G with IC50 of 1-7 nM.Rencofilstat (CRV431) is more than 13 times more potent than the parent compound, cyclosporine A (CsA).Rencofilstat (CRV431) inhibits liver HBV DNA and HBsAg, reduces liver HBV DNA levels and moderately decreased serum HBsAg levels in HBV transgenic mouse model.Rencofilstat (CRV431) shows potential as a drug candidate for chronic liver diseases. |
|
| DC71479 |
(1R)-Tenofovir amibufenamide |
(1R)-Tenofovir amibufenamide ((1R)-HS-10234) is the isomer of Tenofovir amibufenamide, is an orally active antiviral agent. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) is a HIV infection inhibitor and HBV infection inhibitor. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) can be used for HIV infections, hepatitis B research. |
|
| DC71480 |
Canocapavir |
Canocapavir (ZM-H1505R) has orally antiviral activity. Canocapavir is a HBV capsid inhibitor that can be used in the research of Chronic hepatitis B. . |
|
| DC71481 |
Bepirovirsen
Featured
|
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC). |
|
| DC72151 |
(-)-5′-Noraristeromycin |
(-)-5′-Noraristeromycin is an antiviral agent. (-)-5′-Noraristeromycin also is an enantiomer of 5'-noraristeromycin and can inhibit intracellular HBV replication and virion production. (-)-5′-Noraristeromycin can be used for the research of cancer. |
|
| DC72289 |
AB-836 |
AB-836 is an orally active HBV capsid inhibitor. AB-836 inhibits viral replication by interacting with HBV core protein. |
|
| DC72290 |
DVR-01
Featured
|
DVR-01 is a HBV inhibitor with EC50 values of 1.7 and 1.6 μM in AML12HBV10 and HepDES19 cells, respectively. DVR-01 shows antiviral activity against drug-resistant HBV mutants with EC50s of 2.403-3.273 μM. DVR-01 can be used for the research of HBV infection and related diseases. |
|
| DC72574 |
Lagociclovir valactate |
Lagociclovir valactate is a prodrug of Lagociclovir. Lagociclovir valactate is an orally active anti-HBV agent. |
|
| DC72575 |
trans-ccc_R08 |
trans-ccc_R08 (compound 1-B) is a potent cccDNA (covalently closed circular DMA) inhibitor. trans-ccc_R08 inhibits HBeAg level with an IC50 value of 0.08 µM. trans-ccc_R08 has the potential for the research of Hepatitis B Virus infection (HBV). |
|
| DC72576 |
cis-ccc_R08 |
cis-ccc_R08 (compound 1) is a flavonoid derivative that can be used in the study of hepatitis B virus (HBV) infection. cis-ccc_R08 is a cccDNA (covalently closed circular DNA) inhibitor. |
|
| DC72577 |
ccc_R08 |
ccc_R08 is a non-cytotoxic and orally active cccDNA inhibitor that reduces cccDNA levels in the liver of HBV-infected mice. ccc_R08 can be used in the study of HBV virus (hepatitis B virus) infection. |
|
| DC72979 |
DF-006 |
DF-006 is a small molecule, orally active Alpha-kinase 1 (ALPK1) agonist, activates ALPK1 and stimulates host innate immunity locally in liver, DF-006 enacts potent anti-HBV responses in mouse models of HBV and in primary human hepatocytes. |
|
| DC72980 |
E-CFCP |
E-CFCP is a novel long-acting nucleotide reverse transcriptase inhibitor (NRTI) against HBV, shows potent activity against HBV WTD1 and HBV WTC2 with IC50 of 1.8 and 0.7 nM, respectively. |
|
| DC72981 |
Neracorvir |
Neracorvir is a potent anti-HBV agent, targets HBV surface antigen. |
|
| DC72982 |
SAG-524 |
SAG-524 (SAG524) is a potent and orally bioavailable small molecule inhibitor of HBV replication, reduces HBsAg and HBV-DNA (IC50 = 0.92 nM and 1.4 nM) by destabilizing HBV-RNA. |
|
| DC72983 |
ZINC20451377
Featured
|
ZINC20451377 is a small molecule that binds to hepatitis B surface antigen (HBsAg) with high affinity (Kd=65.3 nM), reduces HBsAg levels and HBV virion secretion in cell culture model for HBV. |
|
