Home > RNA Delivery > siRNA/ASOs/Aptamer drugs

siRNA/ASOs/Aptamer drugs

You can also try the following methods, and our professionals will serve you Customized Consultation
Cat. No. Product Name Field of Application Chemical Structure
DC47280 Nusinersen Featured Nusinersen is an antisense oligonucleotide drug that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein.
DC47285 Tofersen Featured Tofersen (BIIB067) is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen can be used for the research of amyotrophic lateral sclerosis (ALS).
DC47287 Tivanisiran Featured Tivanisiran (SYL1001) is a siRNA used for the study of dry eye disease. Tivanisiran was designed to silence transient receptor potential vanilloid 1 (TRPV1).
DC47290 Remlarsen Featured Remlarsen (MRG-201), a miR-29b mimic, acts a miR-29b agonist. Remlarsen has the potential for preventiong formation of a fibrotic scar or cutaneous fibrosis.
DC47291 Miravirsen Featured Miravirsen (SPC-3649), a β-d-oxy-locked nucleic acid-modified phosphorothioate antisense oligonucleotide, inhibit the biogenesis of miR-122. Miravirsen (SPC-3649) is used in the study for HCV infections.
DC47292 Inclisiran Featured Inclisiran (ALN-PCSsc) is a double-stranded small interfering RNA (siRNA) molecule that inhibits the transcription of PCSK-9. Inclisiran can be used for hyperlipidemia and cardiovascular disease (CVD) research.
DC47306 ARO-AAT Featured ARO-AAT is a second-generation RNAi drug. ARO-AAT consistes of a cholesterol-conjugated RNAi trigger (chol-RNAi) to selectively degrade AAT mRNA by RNAi and a melittin-derived peptide conjugated to N-acetylgalactosamine (NAG) formulated as the excipient EX1 to promote endosomal escape of the chol-RNAi in hepatocytes.
DC47308 Lumasiran Featured Lumasiran (ALN-G01), a siRNA product, reduces hepatic oxalate production by targeting glycolate oxidase. By silencing the gene encoding glycolate oxidase, Lumasiran depletes glycolate oxidase and thereby inhibits the synthesis of oxalate, which is the toxic metabolite that is directly associated with the clinical manifestations of Primary hyperoxaluria type 1 (PH1).
DC47310 Rovanersen Featured Rovanersen (WVE-120101) is an antisense oligonucleotide that can be used for huntington’s disease research.
DC71481 Bepirovirsen Featured Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
DC72286 Fomivirsen Featured Fomivirsen (ISIS-2922 free base) is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen is an antiviral agent that is used cytomegalovirus retinitis (CMV) research, incluiding in AIDs. Fomivirsen binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation.
DC67023 Amvuttra Featured
DC67024 Inotersen Featured Inotersen is an antisense oligonucleotide that inhibits hepatic production of transthyretin (TTR). The free form of the compound is prone to instability, it is advisable to consider the stable salt form (Inotersen sodium) that retains the same biological activity.
DC67025 Mipomersen Featured Mipomersen (ISIS 301012 free base) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen can be used for the research of homozygous familial hypercholesterolemia (HoFH). The free form of the compound is prone to instability, it is advisable to consider the stable salt form (Mipomersen sodium) that retains the same biological activity.
DC67027 Onpattro Featured
DC67028 Pegaptanib Featured
<PrevNext >

Customized Consultation X

Your information is safe with us. * Required Fields.

Your name
Company
Email
Procuct Name
Cat. No.
Remark
Verification code
Please fill out the characters in the picture
X
>