Rencofilstat (CRV431) is a non-immunosuppressive analogue of cyclosporine A and pan-cyclophilin inhibitor, potently inhibits cyclophilin isoforms A, B, D, and G with IC50 of 1-7 nM.Rencofilstat (CRV431) is more than 13 times more potent than the parent compound, cyclosporine A (CsA).Rencofilstat (CRV431) inhibits liver HBV DNA and HBsAg, reduces liver HBV DNA levels and moderately decreased serum HBsAg levels in HBV transgenic mouse model.Rencofilstat (CRV431) shows potential as a drug candidate for chronic liver diseases.

Rv1625c agonist V-59 (V-59) is a specific small molecule agonist of the Mtb adenylyl cyclase Rv1625c, inhibits Mtb growth in macrophages (EC50=0.3 uM) in an Rv1625c-dependent mechanism.V-59 inhibits Mtb growth in cholesterol media (EC50 0.70 uM), but not in media containing the two-carbon fatty acid acetate, or in standard rich growth media.V-59 stimulates Rv1625c to produce cAMP, which is necessary for V-59 to inhibit Mtb growth.Chemically activating Rv1625c via V-59 preferentially inhibits cholesterol utilization in WT Mtb, rather than equally inhibiting all lipid utilization by the bacterium.

S2C3 is a small molecule HIV-1 fusion inhibitor, targets the membrane proximal external region (MPER) of HIV-1 envelope spike.S2C3 interacted with gp41-inter with an affinity of 2.0 uM.S2C3 has been shown to effectively block binding to the intact HIV-1 Env expressed on the cell surface by soluble CD4 but not by CD4 binding the sitedirected NAb VRC01, or the prefusion conformation-specific NAb PG16.S2C3 targets a site in the HIV-1 Env distinct from sites targeted by small-molecule entry inhibitors that have been identified so far.S2C3 could stabilize HIV-1 Env in the prefusion conformation, making it potentially useful in a vaccine preparation to reduce the conformational flexibility of Env.

SBI-0637142 is a potent Smac mimetic that preferentially targets BIRC2, latency-reversing agent (LRA), specifically and potently promote HIV-1 latency reversal activity.SBI-0637142 modestly induced HIV-1 latency ex vivo in CD4+ T cells from ART-suppressed aviremic HIV-infected patients as a single agent, showed robust activity when administered in combination with the HDACi panobinostat.SBI-0637142's latency reversal activity is dependent on the NIK-dependent NF-κB signaling.

SBI-0797750 (SBI 0797750) is a potent, fully selective PfGluPho inhibitor with robust nanomolar activity against recombinant PfGluPho, PvG6PD, and P. falciparum blood-stage parasites.SBI-0797750 disturbs the cytosolic glutathione-dependent redox potential, as well as the cytosolic and mitochondrial H2O2 homeostasis of P. falciparum blood stages, at low nanomolar concentrations.SBI-0797750 does not harm red blood cell (RBC) integrity and phagocytosis and thus does not promote anemia.

SRI-41897 is a specific small molecule inhibitor of HIV-1 N-terminal region of NL4-3 Vpu (HIV-1 NL4-3 Vpu) with EC50 of 4.4 uM in the GaLV inhibition assays.SRI-41897 blocks Vpu-mediated modulation of CD4, BST-2/Tetherin and antibody dependent cell-mediated toxicity (ADCC).SRI-41897 rescues CD4 surface expression by 47% on infected TZM-GFP cells, also rescues the expression of CD4 and Tetherin in human peripheral blood mononuclear cells (PBMCs).

UAMC-03011 is a potent anti-trypanosomal compound (IC50=0.63 uM, T. brucei).UAMC-03011 displays selectivity for Trypanosoma brucei over a panel including Trypanosoma cruzi, L.eishmania infantum, and Plasmodium falciparum (IC50>64 uM).

Xeruborbactam (QPX7728) is an ultrabroad-spectrum beta-lactamase inhibitor, inhibits class A extended-spectrum beta-lactamases with IC50 of 1-3 nM, carbapenemases such as KPC (IC50, 2.9 nM), class C P99 (IC50, 22 nM).QPX7728 displays a remarkably broad spectrum of inhibition, including class B and class D enzymes.QPX7728 is also a potent inhibitor of class D carbapenemases such as OXA-48 from Enterobacteriaceae and OXA enzymes from Acinetobacter baumannii (OXA-23/24/58, IC50 range, 1 to 2 nM) as well as MBLs such as NDM-1 (IC50, 55 ± 25 nM), VIM-1 (IC50, 14 ± 4 nM), and IMP-1 (IC50, 610 ± 70 nM).QPX7728 restored the potency of meropenem against carbapenem-resistant Enterobacterales (CRE), with the meropenem MIC90 decreasing from >64 μg/ml to 0.5 μg/ml for QPX7728 (8 μg/ml).

ZHAWOC21026 is a highly potent, host-specific small-molecule inhibitor of paramyxovirus (Canine distemper virus, CDV IC50=3.2 nM) and pneumovirus (RSV, IC50=31 nM) replication.

ZHAWOC9045 (F2205-0189) is a potent, host-specific small-molecule inhibitor of paramyxovirus (Canine distemper virus, CDV IC50=0.7 uM) and pneumovirus (RSV, IC50=5.9 uM) replication.ZHAWOC9045 displays broad-spectrum antiviral activity, inhibits CDV in a host cell-dependent manner.

G092 is a potent inhibitor of MsbA. MsbA is an ABC transporter. Transmembrane ATP-binding cassette (ABC) transporters are crucial cellular machines that move molecules small and large across membranes. G092 has the potential for the research of antimicrobial drugs.

GA-O-02, a 18β-Glycyrrhetinic acid derivative, is a potent antimicrobial and anti-inflammatory agent. GA-O-02 exerts anti-inflammation through the inhibition of NO, pro-inflammatory cytokines and chemokines. GA-O-02 displays a high antimicrobial activity against Gram-positive bacteria.

GA-O-06, a 18β-Glycyrrhetinic acid derivative, is a potent antimicrobial and anti-inflammatory agent. GA-O-06 exerts anti-inflammation through the inhibition of NO, pro-inflammatory cytokines and chemokines. GA-O-06 displays a high antimicrobial activity against Gram-positive bacteria.

Lankacyclinone C is a lankacidin C congener lacking the δ-lactone moiety, with antitumor activity.

Apigeninidin (Gesneridin) chloride, a 3‐deoxyanthocyanidin, is a fungal growth inhibitor. Apigeninidin chloride is a bioactive red biocolorant.

6'-Sialyllactose (sodium), a predominant milk oligosaccharide, reduces the internalisation of Pseudomonas aeruginosa in human pneumocytes.

CBR-3465 is a mycobacterium tuberculosis (Mtb) type II NADH dehydrogenase inhibitor, with the MIC of 0.16 μM against Mtb.

CBR-6672 is a mycobacterium tuberculosis (Mtb) type II NADH dehydrogenase inhibitor, with the MIC of 0.14 μM against Mtb.

Cefcapene pivoxil is an orally active cephalosporin antibiotic. It is a precursor agent that dissociates into free acid and then exerts antibacterial effect.

STC314 is a small polyanion that interact electrostatically with histones. STC314 blocks disruption of lipid-bilayers by histones that inhibits the cytotoxic, platelet-activating and erythrocyte-damaging effects of histones. STC314 has anti-infective effects and can be uesd for sepsis research.

W13 is a potent MsbA inhibitor. W13 is an ATPase stimulator with an EC50 of 5.5 µM.

Cladosporin is a fungal metabolite produced in good yield in the mycelium of Cladosporium cladosporioid. Cladosporin completely inhibits growth of severa dermatophytes on agar medium at a concentration of 75 μg/mL.

F-17 is a potential inhibitor of virulence factor. F-17 shows very significant inhibitory effect on biofilm, elastase, pyocyanin, and swarming motility. F-17 also shows a good binding effect on LasR and PqsR. F-17 has no obvious cytotoxicity.

FWM-3 is a potent SARS-CoV-2 NSP13 helicase inhibitor.

INSCoV-600K(1) is a potent inhibitor of Mpro (3CLpro). Proteases (PL pro and 3CL pro) are involved with transcription and replication of the virus. INSCoV-600K(1) has the potential for the research of SARS-CoV-2 infection (extracted from patent WO2021219089A1).

INSCoV-601I(1) is a potent inhibitor of Mpro (3CLpro). Proteases (PL pro and 3CL pro) are involved with transcription and replication of the virus. INSCoV-601I(1) has the potential for the research of SARS-CoV-2 infection (extracted from patent WO2021219089A1).

INSCoV-614(1B) is a potent inhibitor of Mpro (3CLpro). Proteases (PL pro and 3CL pro) are involved with transcription and replication of the virus. INSCoV-614(1B) has the potential for the research of SARS-CoV-2 infection (extracted from patent WO2021219089A1).

Lactonic sophorolipid is a natural antimicrobial surfactant for oral hygiene. Lactonic sophorolipid, a potential anticancer agent, induces apoptosis in human HepG2 cells through the caspase-3 pathway.

Napyradiomycin A1 is one enantioselective compound of napyradiomycins. napyradiomycins are an intriguing family of halogenated natural products with activity against several tumor cell lines as well as some bacterial strains.

Nullscript is a negative control for Scriptaid. Nullscript is a known inactive analog of Scriptaid. Scriptaid is a representative HDAC inhibitor. Nullscript inhibits Cryptosporidium (C. parvum) growth with the IC50 value of 2.1 μM.

RYL-552S kills drug-resistant strains of Plasmodium falciparum. RYL-552S can efficiently kill asexual blood-stage parasites in vitro.

Sulochrin is a metabolite produced by Aspergillus terreus var. aureus. I. Sulochrin has antimicrobial activities.

Tomopenem (CS-023; RO4908463; R-115685) is a longer-half-life parenteral carbapenem. Tomopenem shows broad activity against 63 reference species. The activity of tomopenem against 293 clinical isolates is potent (MIC90, 0.06 to 4 μg/mL). Antianaerobic activity.

Tropesin (VUFB 12018; Repanidal) is a nonsteroid antiinflammatory agent (NSAIA) that inhibits the growth of Trichoderma viride.

AL-470 is a potent antiviral agent with EC50 values of 0.27, 0.63, and 0.35 µM against HIV-1, HIV-2, and EV-A71, respectively.

As-358 has inhibitory effects against Ebola virus and Marburg virus, with IC50s of 47.5 μM and 3.7 μM.

SP-471 is a potent dengue virus (DENV) protease inhibitor with IC50 value of 18 μM. SP-471 inhibits both intermolecular and intramolecular protease processes of DENV.

SP-471P is a potent dengue virus (DENV) protease inhibitor with EC50s of 5.9 μM, 1.4 μM, 5.1 μM and 1.7 μM for DENV1, DENV2, DENV3 and DENV4, respectively and CC50 value over 100 μM. SP-471P can reduce DENV viral RNA synthesis.

Umifenovir is a potent, orally active broad-spectrum antiviral agent with activity against a number of enveloped and non-enveloped viruses. Umifenovir is used as an anti-influenza virus agent. Umifenovir could effectively inhibit the fusion of virus with host cells. Umifenovir is an efficient inhibitor of SARS-CoV-2 in vitro. Umifenovir shows anti-inflammatory activity.

Hydroxyethylamine (Compd VII) is a SARS-CoV-2 3CLpro inhibitor with an IC50 of ~10 μM in the spread assay. Hydroxyethylamine has potent antiviral activities.

IMB-26 is a HCV inhibitor with an EC50 of 2.1 μM. IMB-26 shows potent an anti-HCV activity.

OYYF-175, an antimicrobial antifolate, is a dihydrofolate reductase (DHFR) inhibitor with an IC50 of 2.36 nM for Escherichia coli DHFR. OYYF-175 exhibits potent broad-

Bleomycin A2, an antitumor antibiotic promoting DNA-degradation, is an aspartate/asparagine-β-hydroxylase (AspH) inhibitor with an IC50 of 1.47 μM.

G247 is a specific MsbA inhibitor. G247 acts as a transmembrane domains (TMDs) wedge, symmetrically increasing nucleotide-binding domains (NBDs) separation and preventing conformational transition of MsbA. G247 suppresses ATPase activity by increasing inter-NBD distance.

VV116, also known as JT001, is an oral drug candidate of nucleoside analog against SARS-CoV-2. VV116 is a deuterated, tri-isobutyrate ester prodrug of the RDV parent nucleoside, and is rapidly metabolized into the parent nucleoside (116-N1) in the body. 116-N1 is intracellularly converted to the nucleoside triphosphate active form, which would interfere with the function of RNA-dependent RNA polymerase of SARS-CoV-2, thus exerting antiviral effects (Fig. 1). VV116 showed potent activity against a panel of SARS-CoV-2 variants (alpha, beta, delta, and omicron) and excellent therapeutic efficacy in the mice model.

844-TFM is a NBTI (novel bacterial topoisomerase inhibitor) DNA gyrase inhibitor, with an IC50 of 1.5 μM. 844-TFM exhibits bactericidal properties against M. abscessus.

GSK2556286 (GSK286) is an orally active inhibitor of M. tuberculosis. GSK2556286 inhibits growth within human macrophages (IC50 = 0.07 μM). GSK2556286 is effective against both multidrug-resistant (MDR) or extensively drug-resistant (XDR) and drug-sensitive (DS) M. tuberculosis.

Thaxtomin A is a major phytotoxin produced by S. scabies.

WCK-4234 is a potent β-lactamase inhibitor. WCK-4234 inhibits class A, C, and D β-lactamases activity. WCK-4234 lacks direct antibacterial activity. WCK-4234 potentiates imipenem and meropenem against Enterobacteriaceae with OXA-48/OXA-181 or KPC enzymes, or with combinations of impermeability and AmpC or ESBL activity. WCK-4234 distinctively overcomes resistance mediated by OXA-type carbapenemases.

GSK3036656 (GSK070) is a potent, selective and orally active inhibitor of M. tuberculosis leucyl-tRNA synthetase, with an IC50 of 0.20 μM. GSK3036656 can be used for the research of tuberculosis.

YXL-13 is a potent Pseudomonas aeruginosa (PAO1) inhibitor with an IC50 value of 3.686 μM. YXL-13 can inhibit virulence factors and biofilm formation of PAO1. YXL-13 reduces the pathogenicity and drug resistance of PAO1 by inhibition of the quorum sensing (QS) system. YXL-13 can be used for researching anti-bacteria.

DL-Histidine-15N is a 15N-labeled Pefloxacin.

Sulfametrole is an orally active and potent antibacterial. Sulfametrole can be used for infections research, such as HIV, severe pneumonia and UTIs (urinary tract infections).

Diethylamine NONOate (DEA NONOate, diethylammonium salt) is a nitric oxide donor. Diethylamine NONOate is a potent antimicrobial agent, which can inhibit Escherichia coli growth. Diethylamine NONOate also can enhance preservation of the donor rat heart.

Clorobiocin is a MlaC protein inhibitor that could bind to the MlaC protein. Clorobiocin has antibacterial effects.

N-Butylthiophosphoric triamide (NBPT) is a potent urease inhibitor. Butylthiophosphoric triamide inhibits nitrification and reduces the conversion of urea to NH3 gas.

PC190723 (Compound 2) is an inhibitor of the bacterial cell division protein FtsZ with an IC50 of 55 ng/ml. FtsZ-IN-3 exhibits anti-staphylococcal activity with MIC values of 1 µg/ml for MSSA and MRSA.

Tribenuron-methyl, a sulfonylurea herbicide agent, can be used as the fungicide agent. Tribenuron-methyl plays an important role in controlling the weeds and diseases in wheat field.

Pradimicin A (PRM-A) is a potent antifungal agent, with an MIC of 4 μg/mL against Candida rugosa. Pradimicin A has antiviral activities against CoV, HIV and other enveloped viruses. Pradimicin A shows aggregation property, and can recognize d-Man in the presence of Ca2+ ion.

Fmoc-Phe-OH-15N is a 15N-labeled Propoxur.

Metyltetraprole is a promising fungicide with EC50 values of both 0.002 ppm against sensitive wild-type and G143A mutant of Zymoseptoria tritici. Metyltetraprole is effective against QoI (quinone outside inhibitor) resistant strains. Metyltetraprole inhibits the respiratory chain via complex III.

1-Methoxyberberine chloride is a plant alkaloid that can be found in Corydalis longipes. 1-Methoxyberberine chloride exhibits antifungal effects.

Sulconazole is a potent antifungal agent in the imidazole class. Sulconazole blocks the NF-κB/IL-8 signaling pathway and CSC (Cancer stem cells) formation. Sulconazole inhibits tumor growth, and can be used for breast cancer research.

WRNA10 is a potent HIV-1 TAR RNA binder with an IC50 of 10 µM and an CC50 of 40 µM.

CI-39 is an antiviral natural product. CI-39 is an NNRTI (non-nucleoside reverse transcriptase inhibit) antiviral agent with an EC50 of 3.40 µM and an CC50 of >30 µM for wild type HIV-1. CI-39 inhibits HIV-1 RT DNA polymerase and ribonuclease H activitiessup.

A3N19 is a potent HIV-1 non-nucleoside reverse transcriptase inhibitor, with an EC50 of 3.28 nM against HIV-1 IIIB.

MMV687807 is an anthelmintic agent which has a good activity against Toxoplasma gondii (T. gondii) with an IC50 value of 0.15 μM and a CC50 value of 1.69 μM.

Coronastat is a potent inhibitor of the SARS-CoV-2 3CL protease. The SARS-CoV-2 3CL protease is a critical drug target for small molecule COVID-19, given its likely druggability and essentiality in the viral maturation and replication cycle.

FWM-1 is a potent SARS-COV-2 NSP13 helicase enzyme inhibitor with binding free energy equals -328.6 kcal/mol. FWM-1 effectively disrupts the binding of ATP to the SARS-COV2 helicase enzyme.

Fmoc-leucine-15N is a 15N-labeled and 13C-labled EIDD-1931. EIDD-1931 (Beta-d-N4-hydroxycytidine; NHC) is a novel nucleoside analog and behaves as a potent anti-virus agent. EIDD-1931 effectively inhibits the replication activity of venezuelan equine ence

FWM-4 is a potent SARS-COV-2 NSP13 helicase enzyme inhibitor.

FWM-5 is a potent NSP13 helicase inhibitor. SARS-COV-2 NSP13 helicase enzyme plays crucial role in the virus life cycle. FWM-5 has the potential for the research of infection diseases.

CRS3123 (REP-3123) dihydrochloride, a fully synthetic antibacterial agent, potently inhibits methionyl-tRNA synthetase (MetRS) of Clostridioides difficile, inhibiting Clostridioides difficile toxin production and spore formation. CRS3123 dihydrochloride is an oral agent for the research of Clostridioides difficile infection (CDI).

WX-081, an anti-tuberculosis agent, displays excellent anti-mycobacterial activity against M. tuberculosis H37Rv and low cytotoxicity.

PXYC12 is a ribosomal protein S1 (RpsA) antagonist with Kds of 2.67 and 4.67 μM for RpsA-CTD and RpsA-CTD Δ438A, respectively. RpsA plays an important role in the trans-translation process of Mycobacterium Tuberculosis (Mtb).

VP-4556 is a potent anti-methicillin-resistant Staphylococcus aureus (MRSA) agent. VP-4556 exhibits significant microbial growth inhibition toward Staphylococcus aureus (ATCC 43300) with MIC of 8 µg/mL. VP-4556 inhibits the growth of methicillin‐resistant Staphylococcus aureus with growth inhibition >95%.

EDA-DA is an unnatural dipeptide building block (an ethynyl-D-alanine and a D-alanine). It incorporates a biorthogonal alkyne group into peptidoglycan (PG) through MurF in the cytoplasmic pathway, which enables selective labeling via a click-chemistry reaction. EDA-DA allows labeling of PG in Gram-positive (B. subtilis), Gram-negative (E. coli and C. trachomatis), Mycobacterium (M. smegmatis) and moss plastids (P. patens) with azide modified fluorescent dyes such as Alexa Fluor 488.

PXYC13 is a ribosomal protein S1 (RpsA) antagonist with Kds of 7.61 and 8.50 μM for RpsA-CTD and RpsA-CTD Δ438A, respectively. RpsA plays an important role in the trans-translation process of Mycobacterium Tuberculosis (Mtb).

PXYC2 is a ribosomal protein S1 (RpsA) antagonist with Kds of 6.35 and 5.11 μM for RpsA-CTD and RpsA-CTD Δ438A, respectively. RpsA plays an important role in the trans-translation process of Mycobacterium Tuberculosis (Mtb).

PXYC1 is a ribosomal protein S1 (RpsA) antagonist with Kds of 0.81 and 0.31 μM for RpsA-CTD and RpsA-CTD Δ438A, respectively. RpsA plays an important role in the trans-translation process of Mycobacterium Tuberculosis (Mtb).

PXYD3 is a ribosomal protein S1 (RpsA) antagonist with Kds of 5.66 and 6.91 μM for RpsA-CTD and RpsA-CTD Δ438A, respectively. RpsA plays an important role in the trans-translation process of Mycobacterium Tuberculosis (Mtb).

ADG-2e is a potent antibacterial agent with MICs of 16, 4, 2, and 2 μg/mL for E. coli [KCTC 1682], P. aeruginosa [KCTC 1637], B.subtilis [KCTC 3068], and S. aureus [KCTC 1621], respectively. ADG-2e shows anti-metastatic activity against breast cancer cells.

Tibezonium iodide, an oropharyngeal disinfectant, has antibacterial activity for the prevention of mouth infections.

LA-Bac8c is a Lipoic acid modified antimicrobial peptide with enhanced antimicrobial properties. LA-Bac8c inhibits S. aureus, MRSA, S. epidermidis, E. coli, and P. aeruginosa with MICs of 1, 4, 8, 8, and 8 μg/mL.

VP-4604 is a potent anti-methicillin-resistant Staphylococcus aureus (MRSA) agent. VP-4604 exhibits significant microbial growth inhibition toward Staphylococcus aureus (ATCC 43300) with MIC of 4-8 µg/mL. VP-4604 inhibits the growth of methicillin‐resistant Staphylococcus aureus with growth inhibition >95%.

PXYD4 is a ribosomal protein S1 (RpsA) antagonist with Kds of 3.24 and 1.64 μM for RpsA-CTD and RpsA-CTD Δ438A, respectively. RpsA plays an important role in the trans-translation process of Mycobacterium Tuberculosis (Mtb).

Callophycin A, red seaweed derived metabolite, is potently against C. albicans. Callophycin A exhibits potent activity against drug resistance vaginal candidiasis.

Prussian blue insoluble (Iron(III) ferrocyanide) is a good adsorbent to be used as antidotes for poisoning with cesium or thallium ions. Prussian blue insoluble (Iron(III) ferrocyanide) has anticancerous and antibacterial properties. Prussian blue insoluble (Iron(III) ferrocyanide) can be used as a contrast agent in photoacoustic and magnetic resonance imaging (MRI). Prussian blue insoluble can be used for contrast agents, antidotes and cancer research.

Methicillin sodium hydrate is a narrow-spectrum β-lactam antibiotic, acts by inhibiting penicillin-binding proteins (PBPs). Methicillin sodium hydrate is active against Staphylococcus aureus and Staphylococcus epidermidis that are resistant to other penicillins. Methicillin sodium hydrate can be used for the research of skin infections, osteomyelitis, and endocarditis.

(1R)-Tenofovir amibufenamide ((1R)-HS-10234) is the isomer of Tenofovir amibufenamide, is an orally active antiviral agent. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) is a HIV infection inhibitor and HBV infection inhibitor. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) can be used for HIV infections, hepatitis B research.

Canocapavir (ZM-H1505R) has orally antiviral activity. Canocapavir is a HBV capsid inhibitor that can be used in the research of Chronic hepatitis B. .

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

RPR103611, the betulinic acid derivative, is a potent HIV-1 entry inhibitor with IC50s of 80, 0.27, and 0.17 for CCR5-tropic virus YU2, CXCR4-tropic virus NL4-3 and dual tropic virus 89.6, respectively.

WAY-383487 is one of the Tat peptide derivatives and inhibits HIV-1 long terminal repeat-activated transcription.

Primaquine is a potent antimalaria agent and a potent gametocytocide in falciparum malaria. Primaquine prevents relapse in vivax and ovale malaria.

Ep vinyl quinidine (3-Epiquinine) is an epi-vinyl stereoisomer of Quinidine. Quinidine is an antiarrhythmic agent. Quinidine is a potent, orally active, selective cytochrome P450db inhibitor. Quinidine is also a K+ channel blocker with an IC50 of 19.9 μM. Quinidine can be used for malaria research.

Piperaquine tetraphosphate is a potent antimalaria agent. Piperaquine tetraphosphate shows inhibition for chloroquine-sensitive and the chloroquine-resistant isolates. Piperaquine tetraphosphate in combination with dihydroartemisinin has the potential for the research of chloroquine-resistant malaria.

PT4 is a therapeutic agent against Cutaneous leishmaniasis (CL). PT4 is effective against both species of Leishmania, with IC50s of 125.18 and 233.18 μM for L. amazonensis and L. braziliensis, respectively. PT4 decreases of mitochondrial membrane potential and increases production of reactive oxygen species, which leads to parasite death. PT4 has a potent in vivo anti-inflammatory activity.

Gemifloxacin, a fluoroquinolone, is a potent and orally active antipneumococcal agent. Gemifloxacin shows bactericidal activity against highly quinolone-resistant pneumococci.Gemifloxacin can be used for the research of respiratory infections, such as community-acquired pneumonia (CAP) and acute exacerbation of chronic bronchitis (AECB).

Ceftaroline fosamil hydrate acetate is a potent cephalosporin antibiotic. Ceftaroline fosamil hydrate acetate shows broad-spectrum activity against Gram-positive pathogens, including methicillin-resistant Staphylococcus aureus (MRSA) and multidrug-resistant Streptococcus pneumoniae, and common Gram-negative organisms. Ceftaroline fosamil hydrate acetate has anti-infective activity, and can be used for the research of complicated skin and skin structure infections (cSSSIs) and community-acquired bacterial pneumonia (CABP).

Erythromycin stearate is a macrolide antibiotic produced by actinomycete Streptomyces erythreus with a broad spectrum of antimicrobial activity. Erythromycin stearate binds to bacterial 50S ribosomal subunits and inhibits RNA-dependent protein synthesis by blockage of transpeptidation and/or translocation reactions, without affecting synthesis of nucleic acid[1][2]. Erythromycin stearate also exhibits antitumor and neuroprotective effect in different fields of research[3][4].

Zanamivir hydrate (5:1) is the hydrate of Zanamivir. Zanamivir is an influenza viral neuraminidase inhibitor with IC50 values of 0.95 nM and 2.7 nM for influenza A and B, respectively.

Ticarcillin is a semisynthetic, extended-spectrum, carboxypenicillin antibacterial agent, and is active against gram-positive cocci, including streptococci and staphylococci. Ticarcillin is also effective against most gram-negative organisms, including Pseudomonas aeruginosa. Ticarcillin can be used in lower respiratory tract infections, skin and skin structure infections, urinary tract infections, and intraabdominal infections research.

Riamilovir (Triazavirin) is a broad-spectrum antiviral drug candidate, which can be used for potential application against the Coronavirus 2019-nCoV.

LL-37, human is a 37-residue, amphipathic, cathelicidin-derived peptide, which exhibits a broad spectrum of antimicrobial activity.

BVDV IN-1 is a non-nucleoside inhibitor of bovine viral diarrhea virus (BVDV), with an EC50 of 1.8 μM.

Gentamicin, an aminoglycoside class of bactericidal antibiotic, is effective against gram-negative bacterial infections.

Alisporivir (Debio-025) is a cyclophilin inhibitor molecule with potent anti-hepatitis C virus (HCV) activity.

Raltegravir (MK 0518) sodium is a potent and orally active integrase (IN) inhibitor, used to treat HIV infection.

HOE961, the diacetate ester prodrug of S2242, is active against respiratory cowpox virus infections, is orally active in infection models. Anti-orthopoxvirus activity.

3-Chlorogentisyl alcohol is a potent E. coli β-glucuronidase inhibitor with an IC50 value of 0.74 µM, an Ki value of 0.58 µM. 3-Chlorogentisyl alcohol shows antiproliferative activity. 3-Chlorogentisyl alcohol has the potential for the research of anti-cancer and anti-inflammatory therapies.

Alpibectir is an antibacterial agent.

ANT3310 sodium is a broad-spectrum covalent Serine β-Lactamase inhibitor, with IC50 values ranging from 1 nM to 175 nM (a panel of Serine β-Lactamase). ANT3310 sodium potentiates activity of β-lactam antibiotics against Carbapenem-Resistant Enterobacterales (CRE) and Acinetobacter baumannii (CRAB). ANT3310 sodium can be used in the research of bacterial infection.

BPH-1086 (compound 10) is an IspH inhibitor, IspH domain fused with ribosomal protein S1 (RPS1) can bind to mRNA or form part of the bacterial ribosome.

P163-0892 is a potent and selective antifungal agent against Cryptococcus species. P163-0892 is predicted to show medium BBB penetration.

Dasabuvir (ABT-333) sodium is a nonnucleoside hepatitis C virus (HCV) polymerase inhibitor. Dasabuvir sodium inhibits RNA-dependent RNA polymerase encoded by the HCV NS5B gene. Dasabuvir sodium inhibits genotype 1a (strain H77) and 1b (strain Con1) replicons, with EC50 values of 7.7 and 1.8 nM, respectively.

Emitasvir (DAG181) diphosphate is an orally active hepatitis C virus (HCV) nonstructural protein 5A (NS5A) inhibitor and can be used for research of chronic hepatitis C virus infection.

GSK5852 (GSK2485852) is an HCV NS5B polymerase inhibitor, with an IC50 value of 50 nM. GSK5852 displays antiviral activity and inhibits HCV with EC50s of 3.0 nM (genotype 1a, GT1a) and 1.7 nM (GT1b), respectively.

EP39 is a potent HIV-1 maturation inhibitor. EP39 interacts with the SP1 domain of Gag. EP39 decreases the dynamics of CA-SP1 junction, by binding to the QVT motif of the SP1 domain, and perturbs the natural coil-helix equilibrium on both sides of the SP1 domain by stabilizing the transient alpha helical structure. EP39 acts by arresting maturation of HIV-1 thereby blocking its infectivity.

ZLM-66 is an orally active non-nucleoside reverse transcriptase inhibitors (NNRTIs) and biphenyl-containing doravirine analog. ZLM-66 shows an EC50 value of 13 nM against wild-type HIV-1. ZLM-66 can be used for the research of HIV.

Penciclovir (VSA 671) sodium is a potent and selective anti-herpesvirus agent with EC50 values of 0.5, 0.8 µg/ml for HSV-1 (HFEM), HSV-2 (MS), respectively. Penciclovir sodium shows anti-herpesvirus activity with no-toxic. Penciclovir sodium preventes mortality in mouse.

Guanabenz (hydrochloride) is an oral α-2-adrenoceptor agonist, has antihypertensive effect and antiparasitic activity. Guanabenz (hydrochloride) interferes ER stress-signalling and has protective effects in cardiac myocytes. Guanabenz (hydrochloride) also is used for the research of high blood pressure(equivalent).

ATV006 is a potent, orally active antiviral agent and ester prodrugs of GS-441524. ATV006 inhibits the replication of SARS-CoV-2 and its variants. ATV006 can be used for SARS-CoV-2 research.

MI-1851 is a potent furin inhibitor. MI-1851 prevents the proteolytic processing of the S protein of SARS-CoV-2 by endogenous flavoprotease in HEK293 cells. MI-185 has antiviral activity.

PLP_Snyder530 is a potent papain-like protease (PLpro) inhibitor. PLP_Snyder530 induces conformational changes in SARS-COV-2 papain-like protease, inhibiting SARS-CoV-2 replication. PLP_Snyder530 can be used for SARS-CoV-2 research.

XR8-89 is a potent papain-like protease (PLpro) inhibitor. XR8-89 induces conformational changes in SARS-COV-2 papain-like protease, inhibiting SARS-CoV-2 replication. XR8-89 can be used for SARS-CoV-2 research.

ZINC000104379474 is a compound that targets SARS-CoV-2 endoribonuclease.

MM-3122 is a selective inhibitor of host cell serine protease TMPRSS2 (transmembrane protease serine 2) with IC50 of 0.34 nM against recombinant full-length TMPRSS2 protein.

Anthramycin, a member of the pyrolobenzodiazepine (PBD) family, is a potent antibiotic. Anthramycin has potent antitumor activity. Anthramycin can act as an potent antagonist of cholecystokinin in the central nervous system in mice.

Boanmycin is an antibiotic with antitumor activity that induces cellular senescence and apoptosis.

Colistin (Polymyxin E) is an orally active polypeptide antibiotic. Colistin has excellent activity against various Gram-negative rod-shaped bacteria, including multidrug-resistant Pseudomonas aeruginosa, Acinetobacter baumannii and Klebsiella pneumoniae. Colistin is associated with nephrotoxicity. Colistin can be used for the research of infections caused by Gram-negative bacilli.

Fabimycin is a FabI inhibitor with potent antibacterial activity against gram-negative bacteria. Fabimycin is effective against drug-resistant gram-negative Infections in vivo.

Kanamycin (Kanamycin A) is an orally active antibacterial (gram-negative/positive bacteria) agent, inhibits translocation and causes misencoding by binding to the 70 S ribosomal subunit. Kanamycin shows good inhibitory activity to both M. tuberculosis (sensitive and drug-resistant ) and K. pneumonia, which can be used in studies of tuberculosis and pneumonia.

Minocycline is an orally active, potent and BBB-penetrated semi-synthetic tetracycline antibiotic. Minocycline is a hypoxia-inducible factor (HIF)-1α inhibitor. Minocycline shows anti-cancer, anti-inflammatory, and glutamate antagonist effects. Minocycline reduces glutamate neurotransmission and shows neuroprotective properties and antidepressant effects. Minocycline inhibits bacterial protein synthesis through binding with the 30S subunit of the bacterial ribosome, resulting in a bacteriostatic effect.

Nemonoxacin (TG-873870) malate is a nonfluorinated quinolone antibiotic. Nemonoxacin malate has broad-spectrum activity against Gram-positive, Gram-negative and atypical pathogens. Nemonoxacin malate can inhibit drug-resistant Streptococcus pneumoniae and Methicillin-resistant Staphylococcus aureus. Nemonoxacin malate can be used for the research of community-acquired pneumonia.

Paritaprevir (ABT-450) dihydrate is a potent, orally active and antiviral non-structural protein 3/4A (NS3/4A) protease inhibitor with EC50s of 1 and 0.21 nM against HCV 1a and 1b, respectively. Paritaprevir dihydrate is also a SARS-CoV 3CLpro inhibitor with an IC50 of 1.31 μM. Paritaprevir dihydrate is metabolized primarily by cytochrome P450 (CYP) 3A. The plasma concentration and half-life of Paritaprevir dihydrate can be enhanced by Ritonavir (a CYP450 inhibitor).

UNC10201652 is a potent Loop 1 (L1)-specific gut bacterial β-glucuronidase (GUSs) inhibitor with an IC50 value of 0.117 μM for E. coli GUS. UNC10201652 can block SN-38 glucuronide processing only in individuals whose fecal gut microbiota is highly abundant in L1 GUS enzymes.

Avibactam sodium (NXL-104) dihydrate is a covalent and reversible non-β-lactam β-lactamase inhibitor which inhibits β-lactamase TEM-1 and CTX-M-15 with IC50s of 8 nM and 5 nM, respectively.

Abacavir hydrochloride is a competitive, orally active nucleoside reverse transcriptase inhibitor. Abacavir hydrochloride can inhibits the replication of HIV. Abacavir hydrochloride shows anticancer activity in prostate cancer cell lines. Abacavir hydrochloride can trespass the blood-brain-barrier and suppresses telomerase activity.

Quinoprazine is a potent inhibitor of Vaccinia virus DNA synthesis with an IC50 value of 10 μM. Quinoprazine has antimalarial activity against Plasmodium berghei and also displays antiprion potency, significantly decreases PrPSc levels-.

MMT5-14 is a remdesivir analogue with a higher antiviral activity in four variants of SARS-CoV-2 than Remdesivir. MMT5-14 inhibits SARS-CoV-2, α, β, γ and δ variants with EC50s of 0.4, 2.5, 15.9, 1.7 and 5.6 μM, respectively. MMT5-14 can be used for the research of COVID-19.

Temafloxacin (TMFX) hydrochloride is an orally active quinolone broad-spectrum antibacterial agent. Temafloxacin hydrochloride is well tolerated in lower respiratory and genitourinary tract infections.

Penamecillin (Wy 20788) an acetoxymethyl ester of Penicillin G. Penamecillin is an orally active antibacterial agent.

Nifurtoinol is a nitrofuran-derivative antibiotic with antibacterial effects. Nifurtoinol can be used for the research of urinary tract infections.

MRV03-037 is a selective colibactin-activated peptidase (ClbP) inhibitor that blocks the genotoxic effect of Colibactin on eukaryotic cells. MRV03-037 prevents gut bacterial genotoxin production.

Azidocillin, a semi-synthetic Penicillin, is an orally active β-lactam antibiotic. Azidocillin bears an azide functionality and retains on-target activity within bacteria. Azidocillin can be used to research osteitis caused by dental surgery, otitis media, enterococcal septicemia and other bacterial infectious diseases.

(R)-(-)-α-Phellandrene ((-)-α-Phellandrene) is an the (R)-(-)-stereoisomer of α-phellandrene. α-phellandrene is an orally active cyclic monoterpene that attenuates inflammatory response, and induces DNA damage.

Megazol is an orally active antibacterial agent. Megazol has effective inhibitory against T. b. brueei with an EC50 of 0.01 μg/mL. Megazol can be used for the research of protozoan infections.

Cefroxadine (CGP 9000) is an orally active cephalosporin antibiotic. Cefroxadine is more effective than cephalexin against Escherichia coli and Klebsiella pneumoniae with MIC values of 3.13 and 1.56 μg/mL respectively with a concentration of 106 μg/mL. Cefroxadine can be used for the research of infection.

Olanexidine is an antibacterial agent. Olanexidine is active against a wide range of bacteria, imcluding both Gram-positive and Gram-negative bacteria Olanexidine is also an antiseptic. Olanexidine can be used in the research of infection and inflammation.

TH-Z145, a lipophilic bisphosphonate, is a FPPS inhibitor (IC50: 210 nM).

Cyclacillin (Wy-4508) is an orally active aminopenicillin antibiotic, shows antibacterial activity against a wide range of gram-positive and gram-negative pathogens.

Octenidine is a potent antibacterial agent, possessing activity against multidrug-resistant Gram-negative pathogens. Octenidine can inhibit the expression of biofilm genes and destroy the formation of biofilms.

GE 2270A (MDL 62879) is an antibiotic. GE 2270A inhibits gram-positive bacteria and anaerobes by inhibiting protein synthesis. GE 2270A can be used for the research of infection.

Diamthazole (Dimazole) is an antifungal agent. Diamthazole can be used for the research of infection.

Nifuroxime is an anti-infective agent. Nifuroxime can be used in the research of fungal infections.

HLF1-11, a human lactoferrin-derived peptide, is a broad spectrum antimicrobial agent. HLF1-11 inhibits human MPO activity. HLF1-11 also directs GM-CSF-driven monocyte differentiation toward macrophages, and enhances immune responses.

(-)-5′-Noraristeromycin is an antiviral agent. (-)-5′-Noraristeromycin also is an enantiomer of 5'-noraristeromycin and can inhibit intracellular HBV replication and virion production. (-)-5′-Noraristeromycin can be used for the research of cancer.

2'-C-Methyladenosine is an inhibitor of hepatitis C virus (HCV) replication. 2'-C-Methyladenosine inhibits HCV replicon and NS5B-catalyzed RNA synthesis with IC50 values of 0.3μM and 1.9 μM, respectively. 2'-C-Methyladenosine also potently inhibits LRV1 in Leishmania guyanensis (Lgy) and Leishmania braziliensis.

L-Fd4A is an adenine derivative. L-Fd4A has anti-human immunodeficiency virus (HIV) (EC50=1.5 μM) and anti-hepatitis B virus (HBV) (EC50=1.7 μM) activity. L-Fd4A has low cytotoxicity.

BI-2540 is a HIV non-nucleoside reverse transcriptase (NNRT) inhibitor.

L-2'-Fd4C, is an l-nucleoside analogue. L-2'-Fd4C has anti-human immunodeficiency virus (HIV) and anti-hepatitis B virus (HBV) activity.

Flutimide is a novel endonuclease inhibitor of influenza virus. Flutimide selectively inhibits endonuclease with an IC50 value of 3 μM. Flutimide shows antiviral activity in cell culture. Flutimide can be used for the research of acute contagious respiratory disease, such as influenza.

Bulaquine (CDRI 80/53) is a potent antimalarial agent which is an analogue of Primaquine. Bulaquine affects multiple metabolism pathways and shows inhibition effect on Plasmodium cynomolgi infection. Bulaquine can be used for the research of malaria.

UCB7362 is an orally active and potent antimalarial plasmepsin X (PMX) inhibitor, with an IC50 of 7 nM. UCB7362 inhibits parasite growth.

Sulfoxone (Aldesulfone) disodium is an orally active sulphonamide antibiotic that is used against leprosy. Sulfoxone disodium can also be used in study of dermatitis herpetiformis.

Flurithromycin ((8S)-8-Fluoroerythromycin A) is an orally active broad spectrum antibiotic. Flurithromycin can be used in the research of bacterial infections.

Peplomycin (Bleomycin PEP; Pepleomycin) is an antibiotic analogue of Bleomycin, with high antitumor effect and less pulmonary toxicity. Peplomycin induce apoptosis in oral squamous carcinoma cell line SSCKN cells and pulmonary fibrosis in rats.

TP-6076 is a fully synthetic fluorocycline antibiotic, acts function via binding to the 30S ribosomal subunit and maintains its activity. TP-6076 displays potent mechanism-based antitranslational activity (Tet protein, IC50=0.18 μg/mL), shows a wide range of antimicrobial and antiparasitic activities.

Grepafloxacin (OPC-17116) hydrochloride is an oral actively fluoroquinolone antibiotic with potent activity against community-acquired respiratory pathogens including Streptococcus pneumonia. Grepafloxacin hydrochloride has high tissue penetration and a promising pharmacodynamic profile.

L-I-OddU, a L-5'-halo- dioxolane nucleoside analogue, is a potent and selective anti-Epstein-Barr virus (EBV) agent with an EC50 value of 0.03μM. L-I-OddU has low cytotoxicity with a CC50 value of 1000 nM. L-I-OddU has antiviral activity by suppressing replicative EBV DNA and viral protein synthesis.

SKF107457 is an HIV-1 protease inhibitor that can be used in AIDS research.

Gallichrome is an active peptide. Gallichrome can interact directly with the hydroxamate moieties of the siderophore. Gallichrome can be used for the research of the uptake of iron in many gram-positive and gramnegative bacteria.

MRV03-070 is an inhibitor of colibactin-activating peptidase ClbP with an IC50 value of 69 nM, acts like biosynthetic precursor precolibactin.

PNU-101603 is a metabolite of Sutezolid. PNU-101603 has excellent activity against Mycobacterium tuberculosis (MTB).

Cefilavancin (TD-1792) is a potent multivalent glycopeptide-cephalosporin heterodimer antibiotic with effective activity against Gram-positive bacteria. Cefilavancin has been used to research skin infections.

Pexiganan (MSI 78 free base) is a synthetic analog of magainin 2. Pexiganan is a potent and orally active broad-spectrum antimicrobial peptide. Pexiganan can be used in the research of infections, such as diabetic foot ulcer infections.

Bio-AMS (TFA) is a potent bacterial biotin protein ligase inhibitor. Bio-AMS (TFA) possesses selective activity against Mycobacterium tuberculosis (Mtb) and arrests fatty acid and lipid biosynthesis.

MK-3402 is a metallo-beta-lactamase inhibitor (Example 303 in reference patent). MK-3402can be used in the research of bacteria.

Fomivirsen (ISIS-2922 free base) is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen is an antiviral agent that is used cytomegalovirus retinitis (CMV) research, incluiding in AIDs. Fomivirsen binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation.

Tolindate is a potent PXR agonist with an EC50 value of 8.3 µM. Tolindate shows antifungal activity.

Picarbutrazox is a potent pesticide and fungicide. Picarbutrazox can be used for corn and soybean to control Pythium and Phytophthora. Picarbutrazox can be used in agricultural production and control.

AB-836 is an orally active HBV capsid inhibitor. AB-836 inhibits viral replication by interacting with HBV core protein.

DVR-01 is a HBV inhibitor with EC50 values of 1.7 and 1.6 μM in AML12HBV10 and HepDES19 cells, respectively. DVR-01 shows antiviral activity against drug-resistant HBV mutants with EC50s of 2.403-3.273 μM. DVR-01 can be used for the research of HBV infection and related diseases.

PSI-353661 (GS-558093) is a purine nucleotide NS5B polymerase inhibitor against HCV infection (EC90: 8 nM). PSI-353661 can produce high concentrations of the active triphosphate in primary human hepatocytes.

JE-2147 (AG1776) is a potent dipeptide protease inhibitor with a Ki of 0.33 nM for HIV-1 protease. JE-2147 has effective activities against a wide spectrum of HIV-1, HIV-2, simian immunodeficiency virus, and various clinical HIV-1 strains in vitro.

Gallic aldehyde is a HSV-1 inhibitor isolated from Geum japonicum, with potent antiviral activity.

WM382 is an orally active and potent dual plasmepsin IX/X (PMIX/X) inhibitor with IC50 values of 1.4 nM and 0.03 nM, respectively. WM382 has robust in vivo efficacy at multiple stages of the malaria parasite life cycle and an excellent resistance profile.

SpdSyn binder-1 is a weak binder, which binds in the active site of plasmodium falciparum spermidine synthase. SpdSyn binder-1 can be used for the research of malaria.

Bofutrelvir (FB2001) is a SARS-CoV-2 main protease Mpro inhibitor with an IC50 value of 53 nM and an EC50 value of 0.53 μM. Bofutrelvir exhibits potent antiviral efficacy against several current SARS-CoV-2 variants with EC50 values of 0.26-0.42 μM. Bofutrelvir has an additive antiviral effect when combined with Remdesivir.

NITD-688 is an orally active pan-serotype inhibitor of the dengue virus NS4B protein. NITD-688 can be used in the research of dengue virus (DENV).

LabMol-301 inhibits both NS5 RdRp and NS2B-NS3pro activity (IC50: 0.8 and 7.4 μM, respectively). LabMol-301 has a cytoprotective effect and prevents Zika virus (ZIKV)-induced cell death.

Balhimycin is a glycopeptide antibiotic, found from the fermentation broth of a Amycolatopsis sp. Balhimycin shows anti-bacterial activity against staphylococci and anaerobes.

Sanfetrinem (GV104326) sodium is a beta-lactamase-stable antibiotic. Sanfetrinem sodium has broad-spectrum activity against gram-positive and gram-negative bacteria.

Nemonoxacin (TG-873870) is an orally active and potent broad-spectrum antibiotic. Nemonoxacin shows good inhibitory activity against different species of staphylococci, streptococci, and enterococci, Neisseria gonorrhoeae, and Haemophilus influenza. Nemonoxacin can be used in the study of bacterial infections and community-acquired pneumonia.

Levonadifloxacin ((S)-(-)-Nadifloxacin; WCK 771) is a broad-spectrum anti-staphylococcal agent. Levonadifloxacin shows antibacterial activity against Methicillin-susceptible Staphylococcus aureus (MSSA) and Methicillin-resistant S. aureus (MRSA) strains.

GS-9256 is a selective HCV NS3 protease inhibitor. GS-9256 has good pharmacokinetic properties and antiviral activity.

XZ426 is a potent integrase strand transfer inhibitor with anti- < a href="https://www.medchemexpress.cn/Targets/HIV.html" class="link-product" target="_blank">HIVactivity.

CL-197 is an orally active and long-acting purine anti-HIV nucleoside reverse transcriptase inhibitor (NRTI). CL-197 has potential effect on the research of viral, oncological and cerebrovascular diseases.

Bischloroanthrabenzoxocinone is a potent Type II fatty acid synthesis (FASII) inhibitor. Bischloroanthrabenzoxocinone inhibits fatty acid synthesis. Bischloroanthrabenzoxocinone shows antibacterial activities and inhibits phospholipid, DNA, RNA, protein, and cell wall synthesis.