Alternate TextTo enhance service speed and avoid tariff delays, we've opened a US warehouse. All US orders ship directly from our US facility.
Home > Products > Featured products

Featured products

You can also try the following methods, and our professionals will serve you Customized Consultation
Cat. No. Product Name Field of Application Chemical Structure
A174 Emibetuzumab Biosimilar(Anti-HGFR / c-Met Reference Antibody) Featured
Emibetuzumab (LY2875358) is a humanized bivalent MET antibody (IgG4 type). Emibetuzumab shows high neutralization and internalization activities, resulting in inhibition of both HGF-dependent and HGF-independent MET pathway activation and tumor growth. Emibetuzumab can be used in study of cancer.
More description
A173 Onartuzumab Biosimilar(Anti-HGFR / c-Met Reference Antibody) Featured
Onartuzumab (MetMAb) is a unique, humanized and affinity-matured monovalent (one-armed) monoclonal antibody against the MET receptor. Onartuzumab potently inhibits HGF binding and receptor phosphorylation and signaling. Onartuzumab has antibody-like pharmacokinetics and antitumor activity.
More description
A172 Amivantamab Biosimilar(Anti-HGFR / c-Met Reference Antibody) Featured
Amivantamab (JNJ-61186372) is a human EGFR-MET bispecific antibody with immune anticancer activity. Amivantamab inhibits ligand binding, promotes endocytosis and degradation of receptor-antibody complexes, and induces Fc-dependent cytokinesis in macrophages and antibody-dependent cytotoxicity in natural killer cells.
More description
A171 Genentech patent anti-HGFA Biosimilar(Anti-HGFA Reference Antibody) Featured
A170 Ficlatuzumab Biosimilar(Anti-HGF / SF Reference Antibody) Featured
Ficlatuzumab is a monoclonal antibody (McAb) targeting human hepatocyte growth factor (HGF). Ficlatuzumab blocks the activation of the HGF/c-Met signaling pathway, and inhibits c-Met receptor-mediated cancer cell proliferation, migration, and invasion.
More description
A169 Rilotumumab Biosimilar(Anti-HGF / SF Reference Antibody) Featured
Rilotumumab (AMG 102) is an anti-HGF (anti-hepatocyte growth factor) monoclonal antibody, inhibits HGF/MET-driven signaling. Rilotumumab shows anti-tumor activity, and can be used in castration-resistant prostate cancer (CRPC) and solid tumor research.
More description
A168 TAK-701 Biosimilar(Anti-HGF / SF Reference Antibody) Featured
A167 Ludwig-Maximilians U. anti_Hepsin Biosimilar(Anti-Hepcidin / HAMP Reference Antibody) Featured
DC22902 SNC-80 Featured
SNC80 (NIH 10815) is a potent, highly selective and non-peptide δ-opioid receptor agonist with a Ki of 1.78 nM and an IC50 of 2.73 nM. SNC80 also selectively activates μ-δ heteromer in HEK293 cells with an EC50 of 52.8 nM. SNC80 shows antinociceptive, antihyperalgesic and antidepressant‐like effects. SNC80 has the potential for multiple headache disorders treatment.
More description
A166 LY2787106 Biosimilar(Anti-Hepcidin / HAMP Reference Antibody) Featured
DC60363 DOSPER Featured
DC71118 SQDG Featured
SQDG is a glycolipid that possesses sugar moieties in their head groups. SQDG is a membrane lipid that can be used to investigate the effects of structural lipid in LNP formulations.
More description
DC60367 EDLPC Featured
DC49194 DPPG sodium Featured
DPPG sodium (1,2-Dipalmitoyl-sn-glycero-3-PG sodium) is a phospholipid containing the long-chain(16:0) palmitic acid inserted at the sn-1 and sn-2 positions. DPPG sodium is used in the generation of micelles, liposomes and other types of artificial membranes.
More description
DC65727 DMPG Featured
DMPG is a phospholipid containing the saturated long-chain (14:0) myristic acid.
More description
DC65728 DSPA Featured
DSPA is a form of phosphatidic acid (PA) containing a phosphatidic acid head group and 18:0 fatty acids
More description
DC67113 DPPE-DBCO Featured
DC65745 POPE Featured
POPE is a phospholipid, and can be used for drug delivery.
More description
DC66297 DSPE Featured
DSPE is a phosphoethanolamine (PE) lipid that can be used in the synthesis of liposomes.
More description
DC66715 HSPC Featured
HSPC is a natural product. Hydrogenated soya phosphatidylcholines can extend drug release in regard to drug loading and solubility for oral drug delivery of watersoluble drugs.
More description
DC67025 Mipomersen Featured
Mipomersen (ISIS 301012 free base) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen can be used for the research of homozygous familial hypercholesterolemia (HoFH). The free form of the compound is prone to instability, it is advisable to consider the stable salt form (Mipomersen sodium) that retains the same biological activity.
More description
DC47308 Lumasiran Featured
Lumasiran (ALN-G01), a siRNA product, reduces hepatic oxalate production by targeting glycolate oxidase. By silencing the gene encoding glycolate oxidase, Lumasiran depletes glycolate oxidase and thereby inhibits the synthesis of oxalate, which is the toxic metabolite that is directly associated with the clinical manifestations of Primary hyperoxaluria type 1 (PH1).
More description
DC67024 Inotersen Featured
Inotersen is an antisense oligonucleotide that inhibits hepatic production of transthyretin (TTR). The free form of the compound is prone to instability, it is advisable to consider the stable salt form (Inotersen sodium) that retains the same biological activity.
More description
DC72286 Fomivirsen Featured
Fomivirsen (ISIS-2922 free base) is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen is an antiviral agent that is used cytomegalovirus retinitis (CMV) research, incluiding in AIDs. Fomivirsen binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation.
More description
DC71481 Bepirovirsen Featured
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
More description
DC47306 ARO-AAT Featured
ARO-AAT is a second-generation RNAi drug. ARO-AAT consistes of a cholesterol-conjugated RNAi trigger (chol-RNAi) to selectively degrade AAT mRNA by RNAi and a melittin-derived peptide conjugated to N-acetylgalactosamine (NAG) formulated as the excipient EX1 to promote endosomal escape of the chol-RNAi in hepatocytes.
More description
DC67023 Amvuttra Featured
DC47285 Tofersen Featured
Tofersen (BIIB067) is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen can be used for the research of amyotrophic lateral sclerosis (ALS).
More description
DC47287 Tivanisiran Featured
Tivanisiran (SYL1001) is a siRNA used for the study of dry eye disease. Tivanisiran was designed to silence transient receptor potential vanilloid 1 (TRPV1).
More description
DC47291 Miravirsen Featured
Miravirsen (SPC-3649), a β-d-oxy-locked nucleic acid-modified phosphorothioate antisense oligonucleotide, inhibit the biogenesis of miR-122. Miravirsen (SPC-3649) is used in the study for HCV infections.
More description

Customized Consultation X

Your information is safe with us. * Required Fields.

Your name
Company
Email
Procuct Name
Cat. No.
Remark
Verification code
Please fill out the characters in the picture
X