SMN2 splicing modulator TEC-1 is a novel specific, CNS penetrant small molecule SMN2 splicing modulator, increases the expression level of FL-SMN2 mRNA and decreases the expression level of Δ7 mRNA.TEC-1 showed higher selectively (>60-fold) on galactosylceramidase and huntingtin gene expression compared to previously reported compounds (e.g., SMN-C3) due to off-target effects on cryptic exon inclusion and nonsense-mediated mRNA decay.TEC-1 modulates SMN2 splicing and displays disease-modifying effects in motor neurons derived from SMA patient iPSCs (GM24468).|TEC-1 rescues the phenotype in a murine model of spinal muscular atrophy (SMA).

SRI-41315 is a small molecule that induces translational readthrough of CFTR nonsense mutations by eRF1 depletion, restores CFTR expression and function, suppresses CFTR nonsense mutations.SRI-41315 induces translational readthrough by depleting eRF1 protein level and prolonging the translational pause that occurs at premature termination codons (PTCs).SRI-41315 reduced eRF1 levels in a manner dependent upon a ubiquitin-mediated proteasome degradation pathway.SRI-41315 in combination with G418 restores CFTR function in primary bronchial epithelial cells derived from a CF patient with CFTR nonsense alleles.

SRX3177 is a potent, triple BRD4/PI3K/CDK4/6 inhibitor with nanomolar potency against PI3Kα (IC50=79 nM), BRD4 bromodomains (BD1 and BD2) (IC50=33 nM and 89 nM, respectively), and CDK4/6 (IC50=2.5/3.3 nM).SRX3177 is capable of targeting BRD4, PI3K and CDK4/6 simultaneously, induces apoptosis and cell cycle arrest and has in vitro efficacy in mantle cell lymphoma, hepatocellular carcinoma and neuroblastoma models.SRX3177 has antitumor efficacy in in vivo xenograft models and is less toxic than the combination of agents that inhibit individual targets.

SRX 3305 is a potent, triple BTK/PI3K/BRD4 inhibitor with IC50 of 6.5 nM, 15 nM, and 4 nM toward BTK, PI3Kɑ and PI3Kδ respectively, inhibits BRD4 BD1 and BD2 with IC50 of 77 and 95 nM.SRX3305 showed enhanced binding to the drug-resistant C481S mutant of BTK compared to SRX-3262 (IC50=9 uM and 25 uM, respectively).SRX3305 displayed cytotoxicity aginst MCL cell lines JeKo-1, Mino, Granta with IC50 of 58 nM, 1 nM, 1.1 uM, respectively.SRX3305 inhibited cell vbiability of JeKo-1 BTK C481S and Mino BTK C481S mutant cell lines with IC50 of 1 uM and 47 nM, respectively, with minimally toxic to healthy donor PBMCs.SRX3305 showed improved efficacy in MCL and Ibrutinib-resistant MCL cells, SRX3305 impacted gene expression, perturbs the cell cycle and promotes apoptosis in MCL.

SS-208 (SS208) is a novel potent, selective inhibitor of histone deacetylase 6 (HDAC6) with IC50 of 12 nM, >100-fold selectivity over HDAC1/4/5/7/8/9/11.SS-208 has minimal effects on the viability of murine SM1 melanoma cells in vitro, significantly reduced in vivo tumor growth in a murine SM1 syngeneic melanoma mouse model.

SSCI-2 is a highly potent, selective NaV1.7 inhibitor with IC50 of 9 and 17 nM on human and rhesus Nav1.7 channels, respectively.SSCI-2 showed robust selectivity over other human and rhesus Nav channel paralogs, with the exception of Nav1.2 channels (IC50 183 nM for hNaV1.2), shows no other channels and receptors in 114 enzymatic, radioligand binding, and cellular assays.SSCI-2 also exhibits high potency in manual patch clamp experiments (IC50=24/62 nM for huma/rhesus Nav1.7 channels).SSCI-2 inhibits withdrawal responses to noxious heat in rhesus monkeys.

SX-682 (SX682) is a potent, allosteric, orally bioavailable inhibitor of CXCR1 and CXCR2.SX-682 enhances tumor infiltration, activation, and the therapeutic efficacy of adoptively transferred NK cells.SX-682 significantly inhibits trafficking of PMN-MDSCs without altering CXCR2 ligand expression.SX-682 enhances T cell-based immunotherapeutic efficacy.

T-518 (T518) is a potent, highly selective, brain penetrant, oral HDAC6 inhibitor with IC50 of 36 nM.T-518 did not obviously inhibit human HDAC1, 4, or 7 at 10 uM, which belongs to Class I or Class IIa HDAC.T-518 showed brain penetration in an oral dose and blocked HDAC6-dependent tubulin deacetylation at Lys40 in mouse hippocampus.T-518 decreased RIPA-insoluble tau accumulation (3-month treatment, 1 and 3 mg/kg), restored impaired axonal transport and novel object recognition in the P301S tau Tg mouse (tauopathy model) by 2-week treatment with dose 1 and 3 mg/kg.

TACH101 (QC8222, TACH 101) is a reversible, α-ketoglutarate competitive, selective and potent inhibitor of KDM4 isoforms A-D with IC50 values of <0.1 uM against all four isoforms.TACH101 demonstrated potent increase of H3K36me3 levels (EC50 <0.001 uM, HTRF) in KYSE-150 cell line engineered to overexpress KDM4C and showed potent anti-proliferative activity in multiple cell lines in OncoPanel.Sub-micromolar levels of TACH101 induced apoptosis in human colorectal (HT-29), esophageal (KYSE-150), and triple negative breast cancer (MDA-MB-231) cell lines with EC50s of 0.033-0.092 uM.TACH101 triggered effective tumor growth control in xenograft models including colorectal, esophageal, gastric, breast, and lymphoma with tumor growth inhibition of up to 100%.

TAK-925 (Danavorexton) is a potent, selective, and brain-penetrant Orexin 2 receptor (OX2R) agonist with EC50 of 5.5 nM, no significant inhibition on OX1R (IC50>100 uM).TAK-925 also showed good selectivity against 106 off-target enzymes and receptors.

TD-1473 (Izencitinib, TD1473, JNJ 8398) is a potent, selective, oral gut-selective pan-JAK inhibitor with pKi of 10.0/10.0/8.8/9.5 for human recombinant JAK1, JAK2, JAK3 and TYK2.TD-1473 inhibited cytokine-induced phosphorylation of STAT1 in mouse primary colonic epithelial cells with pIC50 values for inhibition against IL-6, IFNα and IFNγ were 7.3, 6.8 and 7.0.TD-1473 demonstrated JAK inhibitory activity in ex vivo mouse colon and human IBD patient colonic tissue. TD-1473 (Izencitinib) is under development for the treatment of ulcerative colitis.

TG8-260 is a second-generation, potent, selective EP2 antagonist with Schild KB of 13.2 nM.TG8-260 displays 500-fold selectivity to EP2 against other prostanoid receptors.TG8-260 has a plasma half-life of 2.14 h (PO) and excellent oral bioavailability (77.3%), TG8-260 is a potent inhibitor of CYP450 enzymes.TG8-260 displays antagonistic activity on the induction of EP2 receptor-mediated inflammatory gene expression in microglia BV2-hEP2 cells.TG8-260 reduces hippocampal neuroinflammation and gliosis after pilocarpine-induced status epilepticus in rats.TG8-260 is a tool for investigating anti-inflammatory pathways in peripheral inflammatory disease animal models.

TGP-377/421 (Targapre-miR-377/421) is a smalll molecule targets pre-miR-377 and inhibits its processing, binds to miR-377's Dicer processing site with Kd of 29 uM.TGP-377/421 inhibits the cellular biogenesis of miR-377 in HUVECs, reduced mature miR-377 levels in a dose-dependent fashion with IC50 of 5 uM, also inhibits miR-421.

TH9619 (TH-9619) is a potent and selective inhibitor of folate metabolism enzyme MTHFD2 with IC50 of 47 nM.TH9619 demonstrated efficacy on HL-60 cell viability with EC50 of 11 nM.TH9619 potently inhibits related MTHFD proteins MTHFD2L and MTHFD1-(DC) with IC50 of 47 and 16 nM, respectively.TH9619 displays high potency and cancer selectivity in AML models. induce thymine-less DNA damage and apoptosis, causes uracil misincorporation into DNA, sensitize cancer cells to ATR-signaling blockade.TH9619 impairs cancer progression in vivo.TH9619 displays high selectivity toward binding and stabilizing MTHFD2 over other common folate metabolism targets such as DHFR, thymidylate synthase (TYMS), serine hydroxymethyltransferase (SHMT) 1 and SHMT2.

TTC352 is a synthetic selective estrogen mimic acts as estrogen receptor (ER) partial agonist for the treatment of endocrine-resistant breast cancer.TTC 352 yields an H-bond with Glu353, allows Asp351-to-helix 12 (H12) interaction, sealing ERα's ligand-binding domain, recruiting E2-enriched coactivators, and triggering rapid ERα-induced unfolded protein response (UPR) and apoptosis.TTC-352 is a less potent full estrogen agonist compared to E2, allowing H12 to seal the LBD, which recruits many E2-enriched coactivators, and induces rapid ERα-mediated UPR and apoptosis.

Tucidinostat (Chidamide, HBI-8000, CS055) is a novel histone deacetylase (HDAC) inhibitor with IC50 of 95/160/67/733/78/432 nM for HDAC1/2/3/8/10/11, respectively; shows no activity against Class IIa HDAC4/4/7/9 and HDAC6; demonstrates significant and broad spectrum in vitro and in vivo antitumor activity, induces G1 arrest, ROS-dependent apoptosis and differentiation in human leukaemia cells.

UC-764864 (UC764864) is a small-molecule inhibitor that targeted ubiquitin-conjugating enzyme UBE2N active site.UC-764864 blocks ubiquitination of innate immune- and inflammatory-related substrates in human AML cell lines.Inhibition of UBE2N function disrupted oncogenic immune signaling by promoting cell death of leukemic HSPCs while sparing normal HSPCs in vitro.

UC-764865 (UC764865) is a small-molecule inhibitor that targeted ubiquitin-conjugating enzyme UBE2N active site.UC-764865 blocks ubiquitination of innate immune- and inflammatory-related substrates in human AML cell lines.Inhibition of UBE2N function disrupted oncogenic immune signaling by promoting cell death of leukemic HSPCs while sparing normal HSPCs in vitro.

UHRF1 PHD inhibitor MLD4 is a specific compound that selectively inhibits the UHRF1-histone interaction (IC50=12.4 uM), targets the PHD finger of UHRF1, specifically disrupting histone H3 arginine 2 interactions with the PHD finger.UHRF1 PHD inhibitor MLD4 inhibited binding between H3K9me3(FAM) and UHRF1 with IC50 of 24-26 uM, displace UHRF1-histone H3 binding in cells.

USP10 inhibitor Wu-5 (Wu-5) is a novel small molecule USP10 inhibitor inducing the degradation of FLT3-mutated protein, directly interacts and inactivates USP10, the deubiquitinase for FLT3-ITD in vitro (IC50=8.3 uM) and in FLT3-ITD-positive AML cells.Wu-5 selectively inhibited the viability of FLT3 inhibitor-sensitive (MV4-11, Molm13) and -resistant (MV4-11R) FLT3-ITD-positive AML cells with IC50 of 3.794, 5.056, and 8.386 uM, respectively.Wu-5 (1-10 μM) dose-dependently induced apoptosis of MV4-11, Molm13, and MV4-11R cells through the proteasome-mediated degradation of FLT3-ITD.Combined treatment of Wu-5 and crenolanib produced synergistic cell death in FLT3-ITD-positive cells via the reduction of both FLT3 and AMPKα proteins.

VK-II-86 is a carvedilol analogue lacking antagonist activity at β-adrenoceptors, effectively suppresses SOICR by directly reducing the open duration of the cardiac ryanodine receptor (RyR2).VK-II-86 exhibited >2,000-fold lower beta-AR binding affinity than carvedilol.VK-II-86 prevented stress-induced ventricular tachyarrhythmias in RyR2-mutant mice and did so more effectively when combined with either of the selective beta blockers metoprolol or bisoprolol.VK-II-86 prevented hypokalaemia-induced AP prolongation and depolarization but did not alter AP parameters in normokalaemia.

VT104 (VT-104) is a specific small molecule inhibitor of YAP/TAZ-TEAD-dependent transcription with IC50 of 10.4 nM in YAP reporter assay, pan-TEAD palmitoylation inhibitor.VT104 inhibited palmitoylation of both endogenous TEAD1, TEAD3 proteins in cells.VT104 decreased the levels of palmitoylated TEAD3 and TEAD4 and increased the levels of unpalmitoylated TEAD3 and TEAD4 in the human mesothelioma cell line NCI-H2373.VT104 exhibited inhibitory activity in more mesothelioma cell lines than the TEAD1-selective inhibitor VT103.VT104 (oral administration of 10 and 3 mg/kg) has very strong antitumor efficacy in the human mesothelioma NCI-H226 CDX model, with no effect on body weight gain.

VU0285655-1 is a potent, selective inhibitor of PLD2, induces autophagy in colorectal cancer cells

Xeruborbactam (QPX7728) is an ultrabroad-spectrum beta-lactamase inhibitor, inhibits class A extended-spectrum beta-lactamases with IC50 of 1-3 nM, carbapenemases such as KPC (IC50, 2.9 nM), class C P99 (IC50, 22 nM).QPX7728 displays a remarkably broad spectrum of inhibition, including class B and class D enzymes.QPX7728 is also a potent inhibitor of class D carbapenemases such as OXA-48 from Enterobacteriaceae and OXA enzymes from Acinetobacter baumannii (OXA-23/24/58, IC50 range, 1 to 2 nM) as well as MBLs such as NDM-1 (IC50, 55 ± 25 nM), VIM-1 (IC50, 14 ± 4 nM), and IMP-1 (IC50, 610 ± 70 nM).QPX7728 restored the potency of meropenem against carbapenem-resistant Enterobacterales (CRE), with the meropenem MIC90 decreasing from >64 μg/ml to 0.5 μg/ml for QPX7728 (8 μg/ml).

YX-2-107 is a CRBN-recruiting and specific CDK6-degrading PROTAC with IC50 of 0.69 and 4.4 nM for CDK4 and CDK6 in vitro, selectively degardes CDK6 in Ph+ BV173 ALL cells with a degradation constant of 4 nM.YX-2-107 does not affect expression of IKZF1 and IKZF3, and does not degarde CDK4 protein.YX-2-107 inhibits S-phase entry, cell proliferation, RB phosphorylation, and FOXM1 expression and induces the selective degradation of CDK6 in Ph+ BV173 and SUP-B15 cells.|PROTAC YX-2-107 is bioavailable in mice and pharmacologically active in suppressing Ph+ ALL proliferation in a mouse xenograft of Ph+ ALL, comparable or superior to that of the CDK4/6 enzymatic inhibitor palbociclib.

ZED3197 (ZED-3197) is a novel peptidomimetic direct-acting, potent and selective inhibitor of human FXIIIa, inhibits human plasma derived FXIII‐A2B2 and the recombinant cellular form (FXIII‐A2) with IC50 of 10 and 14 nM, respectively.ZED3197 strongly blocks FXIII‐A2 from mouse, rat, rabbit, dog, and cynomolgus monkey (IC50 8-30 nM), is a significantly weaker inhibitor of FXIII‐A2 from pig (IC50=220 nM).ZED3197 displays 20‐fold to 3000‐fold selectivity against human transglutaminases TG1, TG2, TG3, and TG7.ZED3197 prolonged clot formation, reduced clot firmness, and facilitated clot lysis in whole human blood without affecting the clotting time, indicating minimal impact on hemostasis.ZED3197 effectively decreased the weight of clots and facilitated flow restoration without prolongation of the bleeding time in vivo.

ZH97 is a selective and covalent small-molecule inhibitor of BFL-1 protein with binding Ki of 0.41 uM, >200-fold selectivity over MCL-1.ZH97 does not bind to BCL-xL, BCL-2, TEAD2, TEAD4, MDM2, MDMX, BRD2 BD1, BRD2 BD2, BRD3 BD1, BRD3 BD2, BCL9, PD1/PD-L1 (Ki>400 uM).ZH97 modifies BFL-1 at the C55 residue, blocks BFL-1/BID interaction in vitro.ZH97 dose-dependently increased cytoplasmic cytochrome c level in U937 cells, has cell growth inhibition with IC50 of 2.8 uM, 5.5 uM, 7.7 uM, 6.8 uM, and 3.9 uM in U937, Kasumi-1, K562, MM.1S, and MV4-11 cell lines, respectively.ZH97 inhibits BFL-1/PUMA interaction in cell lysate and is effective in cancer cells that harboring highexpression level of BFL-1.

ZHAWOC21026 is a highly potent, host-specific small-molecule inhibitor of paramyxovirus (Canine distemper virus, CDV IC50=3.2 nM) and pneumovirus (RSV, IC50=31 nM) replication.

ZHAWOC9045 (F2205-0189) is a potent, host-specific small-molecule inhibitor of paramyxovirus (Canine distemper virus, CDV IC50=0.7 uM) and pneumovirus (RSV, IC50=5.9 uM) replication.ZHAWOC9045 displays broad-spectrum antiviral activity, inhibits CDV in a host cell-dependent manner.

ZINC 17988990 is a potent, selective inhibitor of TRPV5 mediated currents, inhibits rbTRPV5/hTRPV5 with IC50 of 106/177 nM, showing marked selectivity for TRPV5 over TRPV6.ZINC 17988990 shows no activity on other TRP channels (TRPV1, TRPV3, TRPV4 and TRPM8) at 1-3 uM, and moderate inhibition on TRPV3 and TRPM8 at >10 uM.ZINC17988990 (10 uM) fully inhibited Ca2+ signals elicited by application of external Ca2+ in HEK293 cells transfected with TRPV5, but had no effect in cells expressing TRPV6.

ORM‐11372 is a potent and highly selective NCX 1.1 inhibitor, inhibits human NCX 1.1 reverse and forward currents with IC50 of 5 and 6 nM respectively.ORM‐11372 weakly inhibits human cardiac sodium 1.5 (I Na) and hERG KV11.1 currents (I hERG) with IC50 of 23.2 and 10.0 uM.ORM‐11372 decreased both the outward and inward currents of hiPSC‐CMs with IC50 of 4.8 and 5.6 nM respectively, reduced the magnitude of outward I NCX (the reverse mode) in rat primary ventricular CMs with IC50 of 11.3 nM.ORM‐11372 concentration‐dependently inhibited the calcium efflux signa with an IC50 of 142 and 164 nM for experimental conditions increasing intracellular calcium and eliciting NCX forward mode activity, repectively.ORM‐11372 induced positive inotropic effects of 18 ± 6% and 35 ± 8% in anaesthetized rats with myocardial infarctions and in healthy rabbits respectively with no other haemodynamic effects.

BioE-1197 is a novel Pask inhibitor.

Cyclo(Gly-(L)-Pro) shows immunostimulatory properties. Cyclo(Gly-l-Pro) exhibits potent inhibition of TNF-α release with the IC50 values of 4.5 ug/mL, respectively, it also exhibits significant diminution of IL-1β and IL-6 mRNA-expression levels and NO production.

Isoxicam is an orally active, long-acting, non-steroidal anti-inflammatory agent for the research of arthritis[1]. Isoxicam is a nonselective inhibitor of COX-1 and COX-2[2].

490BP-C14 is a bisphosphonate lipid-like material for mRNA delivery. 490BP-C14 LPNs could enhance mRNA expression and localization in the bone microenvironment, which overcomes biological barriers to deliver mRNA therapeutics.

CL4H6 is a pH-sensitive cationic lipid. CL4H6 is the main component of lipid nanoparticles (LNPs), which can be used to target and deliver siRNA, and induces a potent gene-silencing response[1][2].

Aminopurvalanol A is a potent, selective, and cell permeable inhibitor of Cyclins/Cdk complexes. Aminopurvalanol A preferentially targets the G2/M-phase transition inhibiting cancer cell differentiation. Aminopurvalanol A causes the inhibition of sperm fertilizing ability via the inhibition of physiological capacitation-dependent actin polymerization[1][2].

(S)-CR8 is the S-isomer of CR8. (S)-CR8 is a potent and selective CDK inhibitor with IC50s of 0.060, 0.080, 0.11, 0.12, and 0.15 μM for CDK2/cyclin E, CDK2/cyclin A, CDK9/cyclin T, CDK5/p25, and CDK1/cyclin B, respectively. (S)-CR8 reduces SH-SY5Y cells survival (IC50 0.40 μM).

14:0 DAP (1,2-dimyristoyl-3-dimethylammonium-propane ) is a cationic lipid that can be used for drug delivery.

4BAB (compound 29) is an irreversible glyoxalase I (GLO1) inhibitor. 4BAB has anticancer effects.

AMT hydrochloride is a selective inhibitor of inducible NOS (iNOS) with Ki of 4.2 nM.

Avatrombopag maleate (AKR-501) is an orally active, nonpeptide thrombopoietin (TPO) receptor agonist (EC50=3.3 nM). Avatrombopag maleate mimics the biological activities of TPO. Avatrombopag maleate increases platelet production by activating the intracellular signaling system, and promotes production of platelets and megakaryocytes from hemopoietic precursor cells. Avatrombopag maleate is a substrate of cytochrome P450 (CYP) 2C9 and CYP3A.

DAUDA (11-(dansylamino) undecanoic acid) is an environment-sensitive fluorescent fatty acid analogue. DAUDA alters its intensities and fluorescent emission spectra on entry into binding proteins. DAUDA is used to determine the relative affinity of natural fatty acids for polymorphs of the Schistosoma mansoni Sm14 fatty acid-binding protein.

DS-3801b is a potent and non-macrolide agonist of GPR38. DS-3801b is expected to be novel gastrointestinal prokinetic agents for the research of functional gastrointestinal disorders such as gastroparesis and chronic constipation.

EDMPC, a cationic lipid, has an enhanced ability to deliver DNA to pulmonary tissues. EDMPC mediates intralobar DNA delivery to rodents.

Fenquizone (MG-13054), a thiazide-like diuretic, exhibits chronic antihypertensive effect. Fenquizone can be used for the research of oedema and hypertension.

FT709 is a potent and selective USP9X inhibitor, an IC50 of 82 nM. USP9X has been linked with centrosome function, chromosome alignment during mitosis, EGF receptor degradation, chemo-sensitization, and circadian rhythms.

NNGH is a stromelysin-1 (MMP-3) inhibitor. MMP-3 is both a direct transcriptional target and a necessary contributor of the Wnt/β-catenin signaling pathway. Matrix metalloproteinases (MMPs) play a well-defined role in later stages of tumor progression.

OB-24 is a potent inhibitor of heme oxygenase-1 (HO-1). Heme oxygenase-1, a member of the heat shock protein family, plays a key role as a sensor and regulator of oxidative stress. OB-24 significantly inhibited cell proliferation in vitro and tumor growth and lymph node/lung metastases in vivo. OB-24 has potential for the research of advanced prostate cancer (PCA).

Pomalidomide-PEG4-COOH is a E3 ligase ligand-linker conjugate. Pomalidomide-PEG4-COOH contains the Pomalidomide based cereblon ligand and 4-unit PEG linker used in PROTAC technology (extracted from patent WO2017184995A1).

SN38 NHS ester is the NHS ester derivative of SN38. SN-38 is an active metabolite of the Topoisomerase I inhibitor Irinotecan. SN-38 inhibits DNA and RNA synthesis. SN38 NHS ester can be used for the synthesis of antibody-drug conjugates (ADCs).

SQDG is a glycolipid that possesses sugar moieties in their head groups. SQDG is a membrane lipid that can be used to investigate the effects of structural lipid in LNP formulations.

Transfectam is a cationic lipid able to interact with DNA to form complexes that mediate efficient gene transfer into various eukaryotic cells.

UDP-GalNAz disodium (UDP-N-azidoacetylgalactosamine disodium) is the analogue of UDP-GalNAc. UDP-GalNAc is the donor substrate of many N-acetylgalactosaminyltransferases, enzymes which transfer GalNAc from the nucleotide sugar to a saccharide or peptide acceptor.

SR2640 (hydrochloride) is a potent and selective competitive leukotriene D4/leukotriene E4 antagonist. SR2640 can be used for researching the role of leukotrienes in human asthma.

VY-3-135 is an orally active, selective acetyl-CoA synthetase 2 (ACSS2) inhibitor with an IC50 value of 44 nM. VY-3-135 displayes no inhibitory activity towards recombinant human ACSS1 or ACSS3. VY-3-135 potently inhibits ACSS2 dependent fatty acid metabolism but has no effect on gene expression in tumors. VY-3-135 inhibits triple negative breast cancer (TNBC) tumor growth in mouse ACSS2high but not ACSS2low tumors models.

NVP-CLR457 (compound 40) is an orally active, potent and balanced pan-class I PI3K inhibitor. NVP-CLR457 shows a clear dose-dependent PK/PD/efficacy relationship. NVP-CLR457 has antitumor activity.

TC-G 24 (Compound 24) is a potent, selective glycogen synthase kinase-3β (GSK-3β) inhibitor with an IC50 of 17.1 nM.

GSK329 is a potent and selective diarylurea inhibitor of the cardiac-specific kinase TNNI3K. GSK329 exhibits positive cardioprotective outcomes in the model of ischemia/reperfusion cardiac injury.

ANR-94 is a potent and selective adenosine A2A receptor (AA2AR) antagonist with an Ki of 46 nM for hAA2AR. ANR 94 has the potential for the research of Parkinson's disease.

CJ033466 is a novel and selective 5-HT4 receptor partial agonist with an EC50 of 9 nM and has gastroprokinetic effect.

KCC009, a transglutaminase 2 (TG2) inhibitor, induces p53-independent radiosensitization.

MOTS-c, a mitochondria-derived peptide (MDP), exerts antinociceptive and anti-inflammatory effects through activating AMPK pathway and inhibiting MAP kinases-c-fos signaling pathway.

VV116, also known as JT001, is an oral drug candidate of nucleoside analog against SARS-CoV-2. VV116 is a deuterated, tri-isobutyrate ester prodrug of the RDV parent nucleoside, and is rapidly metabolized into the parent nucleoside (116-N1) in the body. 116-N1 is intracellularly converted to the nucleoside triphosphate active form, which would interfere with the function of RNA-dependent RNA polymerase of SARS-CoV-2, thus exerting antiviral effects (Fig. 1). VV116 showed potent activity against a panel of SARS-CoV-2 variants (alpha, beta, delta, and omicron) and excellent therapeutic efficacy in the mice model.

TH10785 is a small-molecule activator that binds to the active site of 8-oxo guanine DNA glycosylase 1 (OGG1) and enables the protein to completely cleave the damaged DNA strand, which results in an overall increased repair of oxidative DNA damage.

DSPE-PEG-MAL is one of the reactive phospholipid PEG reagents that can react with sulfhydryl group (mercaptan, -SH). DSPE (1, 2-distearyl-Sn-glycerol 3-phosphate ethanolamine) is a highly hydrophobic saturated 18C phospholipid.

DSPE-PEG-DBCO ammonium is the ammonium salt form of DSPE-PEG-DBCO. DSPE-PEG-DBCO ammonium is utilized in copper-free click chemistry through SPAAC conjugation with an azido-functionalized peptide ligand. DSPE-PEG-DBCO ammonium is applied in drug-delivery and nanoparticle research.

BPKDi is a potent bipyridyl PKD inhibitor with IC50s of 1 nM, 9 nM and 1 nM for PKD1, PKD2 and PKD3, respectively. BPKDi blocks signal-dependent phosphorylation and nuclear export of class IIa HDACs in cardiomyocytes.

Branaplam (LMI070; NVS-SM1) hydrochloride is a highly potent, selective and orally active survival motor neuron-2 (SMN2) splicing modulator with an EC50 of 20 nM for SMN. Branaplam hydrochloride inhibits human-ether-a-go-go-related gene (hERG) with an IC50 of 6.3 μM. Branaplam hydrochloride elevates full-length SMN protein and extends survival in a severe spinal muscular atrophy (SMA) mouse model.

GB1211 is an orally available galectin-3 (Gal-3) inhibitor.

MC2652 (compound 1a) is a potent LSD1 inhibitor. MC2652 displays high inhibiting effects in MV4-11 and NB4 leukaemia cells. MC2652 shows antiproliferative activity against prostate cancer LNCaP cells.

ET-JQ1-OH is an allele-specific BET inhibitor.

Tecastemizole (Norastemizole), a major metabolite of Astemizole, is a potent and selective H1 receptor antagonist. Tecastemizole shows anti-inflammatory activities.

Picotamide is a combined inhibitor of thromboxane A2 (TxA2) synthase and receptor. Picotamide has antiplatelet activity. Picotamide promotes the reduction of microalbuminuria and the inhibition of growth of carotid plaques in diabetes. Picotamide can be used for researching acute or chronic cardiovascular diseases.

UR-MB108 (Compound 57) is a potent, selective ABCG2 (BCRP) inhibitor with an IC50 of 79 nM. UR-MB108 is stable in blood plasma.

BZAD-01 is a potent, selective and orally active inhibitor of NMDA NR2B subunit, with a Ki of 72 nM. BZAD-01 can improve postural asymmetry as well as Apomorphine-induced rotation.

ABBV-318 is a potent Nav1.7/ Nav1.8 blocker, with IC50s of 2.8 μM and 3.8 μM for hNav1.7 and hNav1.8, respectively. ABBV-318 can be used for the research of pain.

(2E)-OBAA is a potent phospholipase A2 (PLA2) inhibitor, with an IC50 of 70 nM. (2E)-OBAA induces apoptosis of HUVEC cells. (2E)-OBAA blocks Melittin-induced Ca2+ influx in Trypanosoma brucei, with an IC50 of 0.4 μM.

Ribavirin carboxylic acid (TR-COOH) is a metabolite of ribavirin, ribavirin has strong antiviral activity.

YSK 05 is a pH-sensitive cationic lipid. YSK 05 improves the intracellular trafficking of non-viral vectors. YSK 05-MEND shows significantly good gene silencing activity and hemolytic activity. YSK 05 overcomes the suppression of endosomal escape by PEGylation. YSK 05 effectively enhances siRNA delivery both in vitro and in vivo.

BPC157 (Bepecin, PL 14736), a small, chemically synthesised pentadecapeptide and a partial sequence of the human gastric juice protein BPC, which has been shown to be safe in clinical trials for inflammatory bowel disease and may be able to cure intestinal anastomosis dehiscence.

NHS-NH-(diethylamino)ethyl benzoate is a compound that can be used for N-glycan labeling.

FAP-2286, a fibroblast activation protein (FAP)-binding peptidic macrocycle coupled to the radionuclide chelator DOTA. FAP-2286 has potent affinity to human FAP protein with a Kd of 1.1 nM. FAP-2286, a tumor imaging agent, is a useful tool for the research of positron emission tomography (PET). FAP-2286 has antitumor activity.

WX-081, an anti-tuberculosis agent, displays excellent anti-mycobacterial activity against M. tuberculosis H37Rv and low cytotoxicity.

EDA-DA is an unnatural dipeptide building block (an ethynyl-D-alanine and a D-alanine). It incorporates a biorthogonal alkyne group into peptidoglycan (PG) through MurF in the cytoplasmic pathway, which enables selective labeling via a click-chemistry reaction. EDA-DA allows labeling of PG in Gram-positive (B. subtilis), Gram-negative (E. coli and C. trachomatis), Mycobacterium (M. smegmatis) and moss plastids (P. patens) with azide modified fluorescent dyes such as Alexa Fluor 488.

VP-4604 is a potent anti-methicillin-resistant Staphylococcus aureus (MRSA) agent. VP-4604 exhibits significant microbial growth inhibition toward Staphylococcus aureus (ATCC 43300) with MIC of 4-8 µg/mL. VP-4604 inhibits the growth of methicillin‐resistant Staphylococcus aureus with growth inhibition >95%.

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

Ansofaxine hydrochloride (LY03005, LPM570065), a triple reuptake inhibitor, inhibits serotonin, dopamine and norepinephrine reuptake with IC50 values of 723, 491 and 763 nM, respectively.

FABPs ligand 6 (MF6) is an FABP5 and FABP7 inhibitor with KD values of 874 nM and 20 nM, respectively. FABPs ligand 6 can be used for multiple sclerosis research.

2-MPPA (GPI-5693) is an orally active and selective glutamate carboxypeptidase II (GCP II; PSMA) inhibitor with an IC50 of 90 nM.

IZTZ-1, an imidazole-benzothiazole conjugate, is a c-MYC G4 ligand. IZTZ-1 is able to downregulate the c-MYC expression by stabilizing c-MYC G4. IZTZ-1 induces cell cycle arrest, apoptosis, thereby inhibiting cell proliferation in B16 cells. IZTZ-1 shows antitumor activity, and can be used for melanoma research.

Haloperidol lactate is a potent antipsychotic agent. Haloperidol lactate can be used in acute and chronic schizophrenia and gilles de la tourette's syndrome. Haloperidol lactate has the potential for the research of psychotic disorders.

WAY-647802 is a CDK inhibitor.

ZINC36395841 is a small-molecule binder of the m6A-reader domain of YTHDC1.

MS8511 is a highly potent, selective, and cell-active covalent inhibitor of G9a (Kd=44 nM) and GLP (Kd=46 nM). MS8511 could be a useful chemical tool for investigating the physiological and pathophysiological functions of G9a and GLP.

TCL053 is an ionizable amino lipid.1 It has been used in the generation of lipid nanoparticles (LNPs) and has a pKa value of 6.8. LNPs containing TCL053 and encapsulating mRNA encoding the Cas9 nuclease, in combination with LNPs containing TCL053 and encapsulating single-guide RNA (sgRNA) targeting the Rosa26 locus, have been used to induce CRISPR-mediated gene editing in the mouse gastrocnemius muscle.TCL053 is an ionizable lipid that has received FDA approval for preparing mRNA vaccines. It is a three-tailed ionizable lipid to overcome the disadvantage of nonrepeatable administration of AAV vectors. In addition, combined with limb perfusion administration, TCL053 iLNPs could transiently deliver CRISPR-Cas9 mRNA and sgRNA to multiple muscle tissues, reducing immunogenicity and increasing the safety of iLNPs. It is great progress for treating Duchenne muscular dystrophy and other diseases that require multiple doses.

NT1-O14B is a tryptamine-containing cationic lipidoid.1 It has been used in combination with other lipids in the formation of lipid nanoparticles (LNPs). Intravenous administration of LNPs containing NT1-O14B and encapsulating antisense nucleotides against tau decreases tau brain levels in mice.

N-[1-(2,3-Dioleyloxy)propyl]-N,N,N-trimethylammonium (DOTMA) is a cationic lipid.It has been used as a component in liposomes that can be used to encapsulate siRNA, microRNAs, and oligonucleotides and for gene transfection in vitro.

Lipid 29 is an ionizable amino lipid (pKa = 6.91) that has been used in combination with other lipids in the formation of lipid nanoparticles (LNPs).Administration of human erythropoietin (EPO) mRNA in lipid 29-containing LNPs increases serum EPO levels in mice.

SB-747651A dihydrochloride is a potent MSK1 inhibitor; also inhibiting other AGC group kinases.

NBI 31772 is a nonpeptide ligand that releases insulin-like growth factor-1 (IGF-1) from its binding protein (IGFBP; Kis = 1-24 nM for the six human subtypes of IGFBP).1,2 As the released IGF-1 is biologically active, NBI 31772 is used to assess the role of IGF-1 in cells and animals, including in neuron survival, skeletal muscle regeneration, and glucose homeostasis.3,4,5

Azidamfenicol is a broad-spectrum chloramphenicol-like antibiotic that is active against Gram-negative and Gram-positive bacteria.1 It inhibits ribosomal peptidyltransferase (Ki = 22 µM).2

FHD286(FHD 286 ) is a BRG1/BRM ATPase inhibitor for the treatment of BAF-related disorders such as acute myeloid leukemia.

MKC-1 is an orally bioavailable, small-molecule, bisindolylmaleimide cell cycle inhibitor with potential antineoplastic activity. MKC-1 and its metabolites inhibit tubulin polymerization, blocking the formation of the mitotic spindle, which may result in cell cycle arrest at the G2/M phase and apoptosis.

RP 70676 is a potent and orally bioavailable inhibitor of ACAT.

Viridicatol is a fungal metabolite that has been found in various Penicillium species as well as Phoma with antimicrobial properties.

AOD-9604 is a potential anti-obesity peptide based on human growth hormone. AOD9604 was originally developed after research on mice, but subsequent studies in human have shown no efficacy for the potential treatment of obesity.

Beclamide is a drug that possesses anticonvulsant activity. It is no longer used. Beclamide is possibly metabolized to 3-chloropropanoic acid in vivo, which binds to the GHB receptor. It has been used as a sedative and as an anticonvulsant. It was studied in the 1950s for its anticonvulsant properties, as a treatment for generalised tonic-clonic seizures. It was not effective for absence seizures. Interest in the drug resumed in the 1990s for its psychiatric properties as an adjunct in the treatment of schizophrenia. While not classified as a DEA controlled substance in the United States, this product can only be sold STRICTLY to universities and research institutions. This product will not be sold to individuals or shipped to residential addresses.

Cadralazine is a peripheral arteriolar vasodilator and an antihypertensive drug.

VU0360172 is a positive allosteric modulator of mGlu5 receptors (EC50 = 16 nM; Ki = 195 nM). VU0360172 is selective for mGlu5 and it displays no significant activity at mGlu1, mGlu2 or mGlu4 receptors.

RUVBL1/2 ATPase-IN-1 (compound 18) is a potent and selective inhibitor of RUVBL1/2 ATPase with IC50 values of 6.0 and 7.7 μM, respectively. RUVBL1 and RUVBL2 are highly conserved AAA ATPases (ATPases Associated with various cellular Activities) and highly relevant to the progression of cancer. RUVBL1/2 ATPase-IN-1 has the potential for the research of cancer diseases.

PF-06821497 (compound 23a) is a potent, selective and orally active Enhancer of Zeste Homolog 2 (EZH2) inhibitor, with a Ki value <0.1 nM against mutant Y641N EZH2. Exhibits robust tumor growth inhibition.

Imiquimod hydrochloride (R 837 hydrochloride), an immune response modifier, is a selective toll like receptor 7 (TLR7) agonist. Imiquimod hydrochloride exhibits antiviral and antitumor effects in vivo. Imiquimod hydrochloride can be used for the research of external genital, perianal warts, cancer and COVID-19.

AM 103 is a potent and selective FLAP inhibitor, with an IC50 value of 4.2 nM.

SRI-37330 hydrochloride is an orally bioavailable thioredoxin-interacting protein (TXNIP) inhibitor. SRI-37330 hydrochloride inhibits glucagon secretion and function, reduces hepatic glucose production and reverses hepatic steatosis. SRI-37330 hydrochloride can be used for type 2 diabetes research.

(Rac)-CFT7455 is a zinc finger transcription factors Ikaros (IKZF1) and Aiolos (IKZF3) degrader, acting via the ubiquitin proteasome pathway, with a GI50 of 0.05 nM for NCIH929.1 cells. (Rac)-CFT7455 is the racemic isomer of CFT7455 which is a IKZF1/IKZF3 degrader with anticancer activity.

GSK-1520489A(EX-A5430) is an active Protein Kinase, Membrane Associated Tyrosine/Threonine 1 (PKMYT1) inhibitor.

IBT6A (BTK inhibitor 1) is an impurity of Ibrutinib, which is a Btk inhibitor (IC50=0.5 nM), and can be used in the synthesis of IBT6A Ibrutinib dimer and IBT6A adduct.

Euquinine is generally used as a febrifuge, antimalarial, and tonic.

Tivozanib hydrochloride hydrate is a potent and selective and orally active VEGFR tyrosine kinase inhibitor with IC50是of 0.21, 0.16, 0.24 nM for VEGFR-1, VEGFR-2, VEGFR-3, respectively. Tivozanib hydrochloride hydrate inhibits angiogenesis and vascular permeability in tumor tissues and shows antitumor activity. Tivozanib hydrochloride hydrate has the potential for the research of metastatic renal cell carcinoma (RCC) .

Ansornitinib is an orally active dual kinase inhibitor that inhibits platelet-derived growth factor receptor (PDGFR) and vascular endothelial growth factor receptor (VEGFR2). Ansornitinib can be used as an antifibrotic agent in lung, liver, kidney, and gastrointestinal fibrotic diseases.

WAY-340935 (VEGFR2-IN-2) can inhibit the function of VEGFR2 and the anti-proliferative activity against the H460 cell line is produced partly by interaction of VEGFR protein.

BVDV IN-1 is a non-nucleoside inhibitor of bovine viral diarrhea virus (BVDV), with an EC50 of 1.8 μM.

DOSPA is a cationic lipid. The formulation of DNA with DOSPA is a very promising transfection system.

Loxoprofenol-SRS tromethamine (HR1405-01), an active metabolite of Loxoprofen, is a Safe intravenous non-steroidal anti-inflammatory drug (NSAID) with superior anti-inflammatory and analgesic activities.

Val-Cit-PAB-MMAF sodium is a drug-linker conjugate for ADC. Val-Cit-PAB-MMAF sodium contains the ADCs linker (peptide Val-Cit-PAB) and a potent tubulin polymerization inhibitor MMAF.

Val-Cit-PAB-MMAF is a drug-linker conjugate for ADC. Val-Cit-PAB-MMAF contains the ADCs linker (peptide Val-Cit-PAB) and a potent tubulin polymerization inhibitor MMAF.

Iu1-248, a derivative of IU1, is a potent and selective ubiquitin specific peptidase 14 (USP14) inhibitor with an IC50 of 0.83 μM.

EZM0414 is a potent, selective, and orally bioavailable inhibitor of Histone-lysine N-methyltransferase SETD2.

IMD-0560 is an Inhibitor of nuclear factor kappa-B kinase (IKK) which can suppress the production of inflammatory cytokines and chemokines.

Lodenafil (Hydroxyhomosildenafil) is a potent phosphodiesterase type 5 (PDE5) inhibitor for the treatment of erectile dysfunction (ED).

Decanoic acid, 2-hexyl-, 6-oxohexyl ester-1 is a lipid product can be used for drug delivery.

Dlin-MeOH is a lipid product for use in drug delivery systems.

K145 is a selective, substrate-competitive and orally active sphingosine kinase-2 (SphK2) inhibitor with an IC50 of 4.3 µM and a Ki of 6.4 µM in biochemical assays.

Amgen-23 (compound 23) is a potent sphingosine kinases (SPHK) inhibitor with IC50 values of 20 nM and 1.6 μM for SPHK1 and SPHK2, respectively. Amgen-23 can be used for researching anticancer.

Dioctadecylamine (DODA) is a secondary amine that has been shown to self-organize in plate-like structures in aqueous solution. Dioctadecylamine exhibits sufficiently hydrophobic properties of nanoparticles and good dispersibility in nonpolar solvent. Dioctadecylamine does not form a monolayer above pH 3.9.

DHAPC is a phospholipid that is very sensitive to oxidation.

Ionizable lipid A6 (di(dec-3-yn-1-yl) 9-((4-(dimethylamino) butanoyl)oxy) heptadecanedioate) was developed by modifying the backbone structure of Dlin-MC3-DMA through introducing alkynyl and ester groups into the lipid tails. Alkyne lipid A6 demonstrated a significant improvement in transfection efficiency (~8.5, ~2.0, and ~2.5-fold higher than the original MC3, C12-200 and cKK-E12 containing LNPs, respectively).The performance of the A6 coprepared into iLNPs with other amine-containing lipid materials (cKKE12) was evaluated, and the molar ratio of the formulation was changed to 35:16.0:46.5:2.5 (A6/cKKE12: DOPE: Chol: PEG). The results showed that these formulations synergistically facilitated more effective mRNA delivery and improved tolerability following single and repeated dosing. It was confirmed that albumin-associated macrophage phagocytosis and endocytosis is an apolipoprotein-independent cellular internalization pathway of iLNPs in the liver. According to the fusion kinetics, the lipids with highfrequency tail protrusion and high lateral diffusion coefficient can perturb and trigger membrane sprouting, which in turn promotes membrane fusion. The application of iLNPs with those lipids (such as A6) may be an effective method to further enhance the release of mRNA in vivo.

S-2302 is a Chromogenic substrate for plasma kallikrein, factor XIa and factor XIIa.

p-Cresol glucuronide is a metabolite of p-cresol, a uremic toxin formed by bacterial fermentation of proteins in the large intestine. It is formed from p-cresol primarily by the UDP-glucuronosyltransferase (UGT) isoform UGT1A6, but also by UGT1A9, in huma

113-O12B is a disulfide bond-containing ionizable cationic lipidoid. 113-O12B LNP, an LN-targeting LNP delivery system, is developed for a mRNA cancer vaccine. The 113-O12B/mRNA shows enhanced expression in APCs compared with ALC-0315/mRNA, indicating the LN-specific targeting ability.

306Oi10 is a branched-chain ionizable lipidoid and may be useful in the generation of lipid nanoparticles (LNPs). 306Oi10 ionizable lipids tail is isodecyl acrylate, affording the lipid tail a carbon branch, which confers significant improvement of the mRNA deliver efficiency. Compared with the straight-tailed 306O10, the 306Oi10 with carbon branches at the lipid tail generates more powerful surface ionization at late endosomal pH of 5.0 to improve the delivery efficiency of mRNA. The studies showed that 306Oi10 iLNPs significantly promoted mRNA expression in liver (more than 10- fold).306Oi10 iLNPs could induce stronger protein expression than two benchmark lipids, C12-200 and DLin-MC3-DMA. The total organ protein expression produced by 306Oi10 iLNPs was threefold higher than MC3 and over 20-fold higher expression than C12-200. The 306Oi10 iLNPs could codeliver three distinct mRNAs (luciferase, mCherry, and erythropoietin), or deliver Cas9 mRNA and single guide RNA (sgRNA) separately. Besides, 306Oi10 iLNPs have the potential of mRNA therapy for hepatocellular carcinoma, because they could target malignant hepatocytes, endothelial cells, and Kupffer cells simultaneously. To enable 306Oi10 iLNPs to deliver mRNA to extrahepatic organs, charged phospholipids were used in place of neutral phospholipids. The substitution of DOPE with DOTAP increased the positive surface charge of iLNPs at pH 7 about fivefold and changed the protein expression ratio of liver/lung from 36:1 to 1:56. Similarly, the substitution of DOPE with PS decreased the positive charge and changed the protein expression ratio of liver/spleen from 8:1 to 1:3. Further, the lung-target of DOTAP was better than that of neutral or anionic lipids, which might reduce immune cells infiltration in the lung.

PL1 is a novel biomimetic phospholipid. PL1 nanoparticle delivery of costimulatory receptor CD137 mRNA improved the immunotherapy with an anti-CD137 Ab to some extent in both tumor models with better results obtained in the B16F10 melanoma model as compared to the A20 lymphoma model.

OF-Deg-Lin is a biodegradable lipid containing an ester group, developed from the nonbiodegradable, linoleic acid derived OF-02; mRNA-LNPs containing OF-Deg-Lin showed high expression in the spleen. The ionizable lipid Of-Deg-Lin was synthesized, which possessed the similar chemical structure with OF-02.Both Of-Deg-Lin and OF-02 had diketopiperazine core and doubly unsaturated tails, and the difference between them was that Of-02 contained nondegradable 1,2-amino-alcohol linkages, whereas Of-Deg-Lin contained degradable ester linkages The change of linker altered iLNPs distribution and mRNA expression in vivo. Although the Of-Deg-Lin iLNPs could accumulate in the liver and spleen, they induced the expression of most functional proteins in B lymphocytes of spleen (over 85% of the total protein), not in the liver. Of-Deg-Lin iLNPs can deliver mRNA and express functional proteins in the spleen specifically, but the mechanism is unclear.

A2-Iso5-2DC18 is a top-performing lipid for mRNA delivery in bone marrow-derived dendritic cells (BMDCs), BMDMs and HeLa cells.

A18-Iso5-2DC18 that could not only deliver mRNA vaccines robustly but also activate the stimulator of interferon genes (STING) pathway. A18-Iso5-2DC18 strongly binds to the stimulator of interferon genes (STING) and induces potent cytolytic T lymphocyte responses, resulting in substantial antitumor immunity (Miao et al. 2019).

306-O12B is a cationic lipidoid.306-O12B LNP is more efficient than MC-3 LNP in inducing loss-of-function mutations in Angptl3 through CRISPR-Cas9-based genome editing. It has been used in the generation of lipid nanoparticles (LNPs). Intravenous administration of LNPs containing 306-O12B and encapsulating an mRNA reporter accumulate specifically in the mouse liver. LNPs containing 306-O12B and encapsulating mRNA encoding the Cas9 nuclease (mCas9) and single-guide RNA targeting Angptl3 (sgAngptl3), the gene encoding angiopoietin-related protein 3, have been used to induce CRISPR-mediated gene knockdown in mice resulting in a reduction of serum Angptl3 protein, LDL, and triglyceride levels. A novel ionizable lipids library was constructed by a combinatory solvent-free Michael addition reaction between disulfide bondincorporated acrylate lipid tails and amine-containing heads. In this library, the tail-branched bioreducible ionizable lipid 306-O12B was screened out. Due to the presence of special ester bonds and branches in lipid tails, the accumulation of iLNPs in the liver was increased, and endosome escape was prompted. These iLNPs were used to deliver CRISPR-Cas9 mRNA and sgRNA targeting to angiopoietin-like 3 (Angptl3). Compared with FDA-approved MC3, 306-O12B induced more specific and efficient Angptl3 gene knockout in the liver, resulting in significant decrease in the levels of serum Angptl3 protein, low-density lipoprotein cholesterol (LDL-C), and triglyceride. According to the molecular shape hypothesis outlined several decades ago, the increase of branches can create ionizable lipids with more cone-shaped structure to enhance the destructiveness of the membrane structure of the endosome and increase mRNA release. However, it is unknown whether the structural stability of iLNPs will be sacrificed with the increase of branches. The optimal branches and chain length need to be further explored.

OF-C4-Deg-Lin is a novel ionizable lipid for RNA delivery. OF-C4-Deg-Lin LNPs entrapping mRNA coding for luciferase induce the majority of protein expression in the spleen, with minimal translation in the liver, and negligible translation in other organs. OF-C4-Deg-Lin LNPs entrapping mRNA coding for luciferase induce the majority of protein expression in the spleen, with minimal translation in the liver, and negligible translation in other organs. To improve the mRNA delivery to extrahepatic tissues, a series of degradable diketopiperazine-based ionizable lipids were synthesized. Through evaluating the mRNA functional activity delivered by iLNPs, it was found that the ionizable lipids with doubly unsaturated lipid tails and linkers containing a length of four carbon aliphatic chain (Of-C4-Deg-Lin) could deliver the mRNA more efficiently. Moreover, compared with cKK-E12 and Invivofectamine, Of-C4-Deg-Lin could specifically induce more than 85% of firefly luciferase expression in spleen,minimal expression in the liver, and insignificant expression in other tissues.

Azido-PEG4-EV-Cit-PAB-MMAE is a precursor of antibody drug conjugate.

Felezonexor, also known as CBS9106, SL-801, and BMS566419, is a novel reversible oral CRM1 inhibitor with CRM1 degrading activity. CRM1 plays an important role in the nuclear export of cargo proteins bearing nuclear exporting signal sequences. CBS9106 inhibits CRM1-dependent nuclear export, causing arrest of the cell cycle and inducing apoptosis in a time- and dose-dependent manner for a broad spectrum of cancer cells, including multiple myeloma cells. CBS9106 reduces CRM1 protein levels significantly without affecting CRM1 mRNA expression. Oral administration of CBS9106 significantly suppresses tumor growth and prolongs survival in mice bearing tumor xenograft without a significant loss in body weight.

NCI-006 is a potent new inhibitor of lactate dehydrogenase (LDH) that disrupts tumor growth in mice. LDH inhibition slows tumor growth but rapidly redirects pyruvate to support mitochondrial metabolism. Inhibiting both mitochondrial complex 1 and LDH suppresses metabolic plasticity of glycolytic tumors in vivo, significantly prolonging tumor growth inhibition.

CP 94253 hydrochloride is a potent and selective serotonin 5-HT1B receptor agonist, with Ki values to be 2 nM for 5-HT1B and 89, 860, 49 and 1600 nM for 5-HT1A, 5-HT1C, 5-HT1D and 5-HT2 receptors respectively.

CO23 is a selective thyroid hormone receptor (TR) α agonist and used for growth and development regulation. CO23 was able to be transported through the blood-brain barrier. CO23 (ip; 0.04-5.0 nmol/g) has ≈50% cholesterol reduction with 0.8 nmol/g dose and higher doses are equally effective. CO23 has no effect at the lowest dose of 0.04 nmol/g and increases Dio1 mRNA 5-, 10-, and 15-fold at the doses of 0.8, 2.5, and 5 nmol/g, respectively.

A AMG510 analogue

BAY 6035 is a potent and selective SMYD3 inhibitor.

HQ461 is a Molecular-glue degrader. HQ461 acts by promoting an interaction between CDK12 and DDB1-CUL4-RBX1 E3 ubiquitin ligase, leading to polyubiquitination and degradation of CDK12-interacting protein Cyclin K (CCNK). Degradation of CCNK mediated by HQ461 compromised CDK12 function, leading to reduced phosphorylation of a CDK12 substrate, downregulation of DNA damage response genes, and cell death.

Zinc Protoporphyrin (Zn(II)-protoporphyrin IX) is an orally active and competitive heme oxygenase-1 (HO-1) inhibitor and markedly attenuates the protective effects of Phloroglucinol (PG) against H2O2[1]. Zinc Protoporphyrin is used as a screening marker of iron deficiency in individual pregnant women and children, but also to assess population iron status in combination with haemoglobin concentration[2]. Zinc Protoporphyrin has anti-cancer activity[3].

BPH-1086 (compound 10) is an IspH inhibitor, IspH domain fused with ribosomal protein S1 (RPS1) can bind to mRNA or form part of the bacterial ribosome.

ATV006 is a potent, orally active antiviral agent and ester prodrugs of GS-441524. ATV006 inhibits the replication of SARS-CoV-2 and its variants. ATV006 can be used for SARS-CoV-2 research.

LCS3 inhibits glutathione disulfide reductase (GSR) and thioredoxin reductase 1 (TXNRD1) (IC50=3.3 µM and 3.8 µM, respectively) synergistically. LCS3 shows anti-tumor activity, and induces apoptosis. LCS3 can be used in lung adenocarcinoma (LUAD) research.

LDCA is a dual-hit metabolic modulator and inhibits LDH-A enzyme activity to stimulate apoptosis in the malignant population. LDCA can be used for the research of oncogenic progression.

Misetionamide is an orally oxathiazin-like compound. Misetionamide is a glyceraldehyde-3-phosphate dehydrogenase (GAPDH) inhibitor with antineoplastic activity. Misetionamide can be used for the research of cancer.

PCLX-001 is an orally acitve, small-molecule, dual N-myristoyltransferase (NMT) inhibitor, with IC50s of 5 nM (NMT1) and 8 nM (NMT2), respectively.

MY-875 is a competitive microtubulin polymerization inhibitor with an IC50 value of 0.92 μM. MY-875 inhibits microtubulin polymerization by targeting colchicine binding sites and activates the Hippo pathway. MY-875 induces apoptosis and has anticancer activity.

MIND4-19 is a potent SIRT2 inhibitor with an IC50 value of 7.0 μM. MIND4-19 can be used for researching Huntington's disease.

Sirtuin modulator 2 (Compound 132) is a sirtuin modulator with an ED50 equal or less than 50 μM.

Aripiprazole (OPC-14597) monohydrate, an atypical antipsychotic, is a potent and high-affinity dopamine D2 receptor partial agonist. Aripiprazole monohydrate is an inverse agonist at 5-HT2B and 5-HT2A receptors and displays partial agonist actions at 5-HT1A, 5-HT2C, D3, and D4 receptors. Aripiprazole monohydrate can be used for the research of schizophrenia and COVID19.

2'-MeCCPA is a potent and selective A1 adenosine receptors (A1AR) agonist. 2'-MeCCPA efficiently inhibits cAMP modulation in both direct pathway medium spiny neurons (dMSNs) and indirect pathway medium spiny neurons (iMSNs).

Sipagladenant (Compound I) is an orally active adenosine receptor A2A inverse agonist. Sipagladenant can be used in frontal lobe dysfunction research.

SPH3127 (DRI 18) is a novel, highly potent, and orally active direct renin inhibitor (recombinant human-renin IC50=0.4 nM, human plasma renin activity IC50=0.45 nM). SPH3127 shows antihypertensive effect and can be used in essential hypertension research.

Chitosan oligosaccharide (COS) is an oligomer of β-(1→4)-linked D-glucosamine. Chitosan oligosaccharide (COS) activates AMPK and inhibits inflammatory signaling pathways including NF-κB and MAPK pathways.

Enclomiphene ((E)-Clomiphene) dihydrochloride is a potent and orally active non-steroidal estrogen receptor antagonist, with antioestrogenic property. Enclomiphene dihydrochloride can be used for the research of ovarian dysfunction, testosterone deficiency, male hypogonadism and type 2 diabetes.

(R)-RP-6306 (183) can be used for the research of Myt1 mediated diseases and kinds of cancer for slowing the progression of cancer.

DOPA-NA is an anionic lipid that can be used to prepare liposomes, micelles and artificial membranes.

BAY 1135626 is used to synthesize BAY 1129980, and use to anti-tumor research. BAY 1129980 is a Auristatin-based anti-C4.4A (LYPD3) antibody–drug conjugate (ADC), is used to non–small cell lung cancer (NSCLC) research.

C24-Ceramide is a sphingolipid that can be used for the lipid membranes composed. C24-Ceramide induces time-dependent changes in membrane properties. C24-Ceramide induces membrane reorganization.

MIF098 is a macrophage migration inhibitory factor (MIF) antagonist. MIF098 inhibits proliferation, migration and fibrosis of pulmonary smooth muscle cells. MIF098 can be used for immunoinflammation-related disease research.

Palvanil is a capsaicin analogue, shows strong desensitizing capability against the TRPV1 receptor. Palvanil shows anti-nociceptive and anti-inflammation effects.

TAS1553 is a potent, orally active protein–protein interaction (PPI) inhibitor with an IC50 values of 0.0396 μM. TAS1553 inhibits DNA replication and reduces intracellular dATP pool. TAS1553 induces apoptosis. TAS1553 can be used for cancer research.